hybkit

GitHub release (latest by date including pre-releases) PyPI Package Version Bioconda Release Hybkit Downloads on Bioconda Docker Image Version Circle-CI Build Status Documentation Status Coveralls Coverage PyPI - Python Version Manuscript DOI, Journal Bioinformatics GNU GPLv3+ License
Welcome to hybkit, a toolkit for analysis of hyb-format chimeric (hybrid) RNA sequence data defined with the Hyb software package by Travis et al. (Methods 2014). This genomic data-type is generated from RNA proximity-ligation and ribonomics techniques such as Crosslinking, Ligation, and Sequencing of Hybrids (CLASH; Helwak et al. (Cell 2013)) and quick CLASH (qCLASH; Gay et al. (J. Virol. 2018)).
This software is available via Github, at http://www.github.com/RenneLab/hybkit .
Full project documentation is available at this documentation.
Project components:
  1. hybkit toolkit of command-line utilities for manipulating, analyzing, and plotting hyb-format data.

  2. The hybkit python API, an extendable documented codebase for creation of custom analyses of hyb-format data.

  3. Integrated analysis of predicted secondary structure (fold) information for the API and command-line utilities.

  4. Example analyses for publicly available qCLASH hybrid sequence data implemented in each of the command-line scripts and hybkit Python API.

Hybkit Toolkit:

The hybkit toolkit includes several command-line utilities for manipulation of hyb-format data:

Utility

Description

hyb_check

Parse hyb (and fold) files and check for errors

hyb_eval

Evaluate hyb (and fold) records to identify / assign segment types and miRNAs using custom criteria

hyb_filter

Filter hyb (and fold) records to a specific custom subset

hyb_analyze

Perform an energy, type, miRNA, target, or fold analysis on hyb (and fold) files and plot results

These scripts are used on the command line with hyb (and associated "vienna" or "CT") files. For example, to filter a hyb and corresponding vienna file to contain only hybrids with a sequence identifier containing the string "kshv":

Example:

$ hyb_filter -i my_hyb_file.hyb -f my_hyb_file.vienna --filter any_seg_contains kshv

Further detail on the usage of each script is provided in the hybkit Toolkit section of this documentation.

Hybkit API:

Hybkit provides a Python3 module with a documented API for interacting with records in hyb files and associated vienna or CT files. This capability was inspired by the BioPython Project. The primary utility is provided by a class for hyb records (HybRecord), a class for fold records (FoldRecord), and file-iterator classes (HybFile, ViennaFile, CTFile, HybFoldIter). Record attributes can be analyzed, set, and evaluated using included class methods.

For example, a workflow to print the identifiers of only sequences within a ".hyb" file that contain a miRNA can be performed as such:

#!/usr/bin/env python3
import hybkit
in_file = '/path/to/my_hyb_file.hyb'

# Open a hyb file as a HybFile Object:
with hybkit.HybFile.open(in_file, 'r') as hyb_file:

    # Return each line in a hyb file as a HybRecord object
    for hyb_record in hyb_file:

        # Analyze each record to assign segment types
        hyb_record.eval_types()

        # If the record contains a long noncoding RNA type, print the record identifier.
        if hyb_record.has_prop('any_seg_type_contains', 'lncRNA')
            print(hyb_record.id)

Further documentation on the hybkit API can be found in the hybkit API section of this documentation.

Example Analyses:

Hybkit provides several example analyses for hyb data using the utilities provided in the toolkit. These include:

Analysis

Description

Type/miRNA Analysis

Quantify sequence types and miRNA types in a hyb file

Target Analysis

Analyze targets of a set of miRNAs from a single experimental replicate

Grouped Target Analysis

Analyze and plot targets of a set of miRNAs from pooled experimental replicates

Fold Analysis

Analyze and plot predicted miRNA folding patterns in miRNA-containing hybrids

These analyses provide analysis results in both tabular and graph form. As an illustration, the example summary analysis includes the return of the contained hybrid sequence types as both a csv table and as a pie chart:

Further detail on each provided analysis can be found in the Example Analyses section of this documentation.

Installation:
Dependencies:
Via PyPI / Python PIP:

PyPI Package Version

The recommended installation method is via hybkit's PyPI Package Index using python3 pip, which will automatically handle version control and dependency installation:

$ python3 -m pip install hybkit
Via Conda:

Bioconda Release Install with Bioconda

For users of conda, the hybkit package and dependencies are hosted on the the Bioconda channel, and can be installed using conda:

$ conda install -c bioconda hybkit
Via Docker/Singularity:

Docker Image Version

The hybkit package is also available as a Docker image and Singularity container, hosted via the BioContainers project on quay.io. To pull the image via docker:

$ docker pull quay.io/biocontainers/hybkit:0.3.3--pyhdfd78af_0

To pull the image via singularity:

$ singularity pull docker://quay.io/biocontainers/hybkit:0.3.3--pyhdfd78af_0
Manually Download and Install:

GitHub release (latest by date including pre-releases)

Use git to clone the project's Github repository:

$ git clone git://github.com/RenneLab/hybkit

OR download the zipped package:

$ curl -OL https://github.com/RenneLab/hybkit/archive/master.zip
$ unzip master.zip

Then install using python setuptools:

$ python setup.py install

Further documentation on hybkit usage can be found in this documentation.

Setup Testing:

Hybkit provides a suite of unit tests to maintain stability of the API and script functionalities. To run the API test suite, install pytest and run the tests from the root directory of the hybkit package:

$ pip install pytest
$ pytest

Command-line scripts can be tested by running the auto_test.sh script in the auto_tests directory:

$ ./auto_tests/auto_test.sh
Copyright:
hybkit is a free, sharable, open-source project.
All source code and executable scripts contained within this package are considered part of the "hybkit" project and are distributed without any warranty or implied warranty under the GNU General Public License v3.0 or any later version, described in the "LICENSE" file.

hybkit Hyb File Specification

Version: v0.3.4

The ".hyb" (hyb file) format is described by [Travis2014] along with the Hyb software package as a "gff-related format that contains sequence identifiers, read sequences, 1-based mapping coordinates, and annotation information for each chimera".

Each line in a hyb file (a hyb "record") contains information about an RNA sequence read identified as a chimera by an RNA hybridization analysis. Each line contains 15 or 16 columns separated by tab characters ("\t") and provides information on each of the two aligned segments identified within the sequence read. The columns are described as follows by [Travis2014]:

Column 1, unique sequence identifier.
Column 2, read sequence [...].
Column 3, predicted binding energy in kcal/mol.
Columns 4–9, mapping information for first fragment of read: name of matched transcript, coordinates in read, coordinates in transcript, mapping score.
Columns 10–15, mapping information for second fragment of read.
Column 16 (optional, [...]), list of annotations in the format: ‘‘feature1=value1; feature2=value2;..."

The hybkit project uses an extended version of this description, including assigning columns reference names, and defining allowed flags.

Columns

#

Name

Description

1

id

Hybrid Read Identifier

2

seq

Read Nucleotide Sequence

3

energy

Predicted Gibbs Free-Energy of Intra-Hybrid Folding

4

seg1_ref_name

Segment 1 Mapping Reference Identity

5

seg1_read_start

Segment 1 Mapping Start on Read

6

seg1_read_end

Segment 1 Mapping End on Read

7

seg1_ref_start

Segment 1 Mapping Start on Reference

8

seg1_ref_end

Segment 1 Mapping End on Reference

9

seg1_score

Segment 1 Mapping Score

10

seg2_ref_name

Segment 2 Mapping Reference Identity

11

seg2_read_start

Segment 2 Mapping Start on Read

12

seg2_read_end

Segment 2 Mapping End on Read

13

seg2_ref_start

Segment 2 Mapping Start on Reference

14

seg2_ref_end

Segment 2 Mapping End on Reference

15

seg2_score

Segment 2 Mapping Score

16

flags

Hybrid Read Analysis Details

Flags

Hyb Flags:

The following four flags are used by the Hyb software package ([Travis2014]). The definitions provided describe how these flags are used in the hybkit package.

count_total - Integer: Total represented hybrid records, if records have been combined.

count_last_clustering - Integer: Total represented hybrid records at last clustering.

two_way_merged - {"0" or "1"} Boolean representation of whether entries with mirrored 5' and 3' hybrids were merged if the record is a combined record.

seq_IDs_in_cluster - String: Comma-separated list of all record IDs of hybrids merged into this hybrid entry.

hybkit Flags:

The following flags are used by hybkit.

read_count - Integer: Number of sequence reads represented by this record. If the record is combined, this represents the total read count for all merged entries.

orient - String: Orientation of strand. Options: "F" (Forward), "IF" (Inferred Forward), "R" (Reverse), "IR" (Inferred Reverse), "U" (Unknown), or "IC" (Inferred Conflicting).

seg1_type - String: Assigned segment type of segment 1, ex: "miRNA" or "mRNA".

seg2_type - String: Assigned segment type of segment 2, ex: "miRNA" or "mRNA".

seg1_det - String: Arbitrary detail about segment 1.

seg2_det - String: Arbitrary detail about segment 2.

miRNA_seg - String: Indicates which (if any) segment mapping is a miRNA. Options are "N" (none), "5p" (seg1), "3p" (seg2), "B" (both), or "U" (unknown).

target_reg - String: Assigned region of the miRNA target. Options are "5pUTR", "C" ([C]oding), "3pUTR", "NON" ([NON]coding), "N" ([N]one), or "U" ([U]nknown).

ext - Integer: "0" or "1", Boolean representation of whether record sequences were bioinformatically extended as is performed by the Hyb software package.

dataset - String: Label for sequence dataset id (eg. source file), when combining records from different datasets.

Other Details

Item

Role

"\t" (tab)

Column Delimiter

"."

Missing Data Placeholder (equivalent to None)

".hyb"

File Suffix

".hyb.gz"

gzipped File Suffix

Disallowed

Header Lines

Disallowed

In-file Comments

Example

An example .hyb format line (courtesy of [Gay2018]):

2407_718    ATCACATTGCCAGGGATTTCCAATCCCCAACAATGTGAAAACGGCTGTC       .       MIMAT0000078_MirBase_miR-23a_microRNA   1       21      1       21      0.0027  ENSG00000188229_ENST00000340384_TUBB2C_mRNA     23      49      1181    1207    1.2e-06

hybkit API

The hybkit API provides a Python3 module with classes allowing parsing and manipulation of hyb-format data as python objects, including built-in analysis and plotting functionality for common tasks in hybrid sequence analysis.

hybkit

Data classes for storing, evaluating, and iterating over records

settings

Constants and settings information for hybkit classes and toolkit scripts

type_finder

Class for customizable identification of segment type from reference identifiers

analysis

Classes for predefined analyses of hyb records

plot

Plotting methods for analysis results

util

Support methods for executable scripts

errors

Error classes for the hybkit package

hybkit (module)

Module storing primary hybkit classes and hybkit API.

This module contains classes and methods for reading, writing, and manipulating data in the hyb genomic sequence format ([Travis2014]). For more information, see the hybkit Hyb File Specification.

An example string of a hyb-format line from [Gay2018] is:

2407_718\tATCACATTGCCAGGGATTTCCAATCCCCAACAATGTGAAAACGGCTGTC\t.\tMIMAT0000078_MirBase_miR-23a_microRNA\t1\t21\t1\t21\t0.0027\tENSG00000188229_ENST00000340384_TUBB2C_mRNA\t23\t49\t1181\t1207\t1.2e-06

Hybkit functionality is primarily based on classes for storage and evaluation of chimeric genomic sequences and associated fold-information:

HybRecord

Class to store a single hyb (hybrid) sequence record

FoldRecord

Class to store predicted RNA secondary structure information for hybrid reads

Also included are classes for reading, writing, and iterating over files containing hybrid information:

HybFile

Class for reading and writing hyb-format files [Travis2014] containing chimeric RNA sequence information as HybRecord objects

ViennaFile

Class for reading and writing Vienna-format files [ViennaFormat] containing RNA secondary structure information in dot-bracket format as FoldRecord objects

CtFile

-BETA- Class for reading Connectivity Table (.ct)-format files [CTFormat] containing predicted RNA secondary-structure information as used by UNAFold as FoldRecord objects

HybFoldIter

Class for concurrent iteration over a HybFile and a ViennaFile or CtFile

HybRecord Class

class hybkit.HybRecord(id: str, seq: str, energy: Optional[Union[float, int, str]] = None, seg1_props: Optional[Dict[str, Union[float, int, str]]] = None, seg2_props: Optional[Dict[str, Union[float, int, str]]] = None, flags: Optional[Dict[str, Any]] = None, read_count: Optional[int] = None, allow_undefined_flags: Optional[bool] = None)

Class for storing and analyzing chimeric (hybrid) RNA-seq reads in hyb format.

Hyb file (hyb) format entries are a GFF-related file format described by [Travis2014] that contain information about a genomic sequence read identified to be a hybrid by a chimeric read caller. Each line contains 15 or 16 columns separated by tabs ("\t") and provides annotations on each component. An example hyb-format line from [Gay2018]:

2407_718\tATCACATTGCCAGGGATTTCCAATCCCCAACAATGTGAAAACGGCTGTC\t.\tMIMAT0000078_MirBase_miR-23a_microRNA\t1\t21\t1\t21\t0.0027\tENSG00000188229_ENST00000340384_TUBB2C_mRNA\t23\t49\t1181\t1207\t1.2e-06

The columns are respectively described in hybkit as:

id, seq, energy, seg1_ref_name, seg1_read_start, seg1_read_end, seg1_ref_start, seg1_ref_end, seg1_score, seg2_ref_name, seg2_read_start, seg2_read_end, seg2_ref_start, seg2_ref_end, seg2_score, flags

(For more information, see the hybkit Hyb File Specification)

The preferred method for reading hyb records from lines is with the HybRecord.from_line() constructor:

# line = "2407_718\tATC..."
hyb_record = hybkit.HybRecord.from_line(line)

This is the constructor used by the HybFile class to parse hyb files. For example, to print all hybrid identifiers in a hyb file:

with hybkit.HybFile('path/to/file.hyb', 'r') as hyb_file:
    # performs "hyb_record = hybkit.HybRecord.from_line(line)" for each line in file
    for hyb_record in hyb_file:
        print(hyb_record.id)

HybRecord objects can also be constructed directly. A minimum amount of data necessary for a HybRecord object is the genomic sequence and its corresponding identifier.

Examples

hyb_record_1 = hybkit.HybRecord('1_100', 'ACTG')
hyb_record_2 = hybkit.HybRecord('2_107', 'CTAG', '-7.3')
hyb_record_3 = hybkit.HybRecord('3_295', 'CTTG', energy='-10.3')

Details about segments are provided via python dictionaries with keys specific to each segment. Data can be provided either as strings or as floats/integers (where appropriate). For example, to create a HybRecord object representing the example line given above:

seg1_props = {'ref_name': 'MIMAT0000078_MirBase_miR-23a_microRNA',
             'read_start': '1',
             'read_end': '21',
             'ref_start': '1',
             'ref_end': '21',
             'score': '0.0027'}
seg2_props = {'ref_name': 'ENSG00000188229_ENST00000340384_TUBB2C_mRNA',
             'read_start': 23,
             'read_end': 49,
             'ref_start': 1181,
             'ref_end': 1207,
             'score': 1.2e-06}
seq_id = '2407_718'
seq = 'ATCACATTGCCAGGGATTTCCAATCCCCAACAATGTGAAAACGGCTGTC'
energy = None

hyb_record = hybkit.HybRecord(seq_id, seq, energy, seg1_props, seg2_props)
# OR
hyb_record = hybkit.HybRecord(seq_id, seq, seg1_props=seg1_props, seg2_props=seg2_props)
Parameters
  • id (str) -- Identifier for the hyb record

  • seq (str) -- Nucleotide sequence of the hyb record

  • energy (str or float, optional) -- Predicted energy of sequence folding in kcal/mol

  • seg1_props (dict, optional) -- Properties of segment 1 of the record, containing possible segment column keys: (ref_name, read_start, read_end, ref_start, ref_end, score)

  • seg2_props (dict, optional) -- Properties of segment 2 of the record, containing possible: segment column keys: (ref_name, read_start, read_end, ref_start, ref_end, score)

  • flags (dict, optional) -- Dict with keys of flags for the record and their associated values. By default flags must be defined in ALL_FLAGS but custom flags can be supplied by changing HybRecord.settings['custom_flags']. This setting can also be disabled by setting 'allow_undefined_flags' to True in HybRecord.settings.

  • allow_undefined_flags (bool, optional) -- If True, allows flags not defined in ALL_FLAGS or HybRecord.settings['custom_flags'] to be added to the record. If not provided, defaults to the value in HybRecord.settings['allow_undefined_flags'].

Variables
  • id (str) -- Identifier for the hyb record (Hyb format: <read-num>_<read-count>)

  • seq (str) -- Nucleotide sequence of the hyb record

  • energy (str) -- Predicted energy of folding

  • seg1_props (dict) -- Information on chimeric segment 1, contains segment column keys: ref_name (str), read_start (int), read_end (int), ref_start (int), ref_end (int), and score (float).

  • seg2_props (dict) -- Information on segment 2, contains segment column keys: ref_name (str), read_start (int), read_end (int), ref_start (int), ref_end (int), and score (float).

  • flags (dict) -- Dict of flags with possible flag keys and values as defined in the Flags section of the hybkit Hyb File Specification.

  • fold_record (FoldRecord) -- Information on the predicted secondary structure of the sequence set by set_fold_record().

  • allow_undefined_flags (bool) -- Whether to allow undefined flags to be set.

HYBRID_COLUMNS = ('id', 'seq', 'energy')

Record columns 1-3 defining parameters of the overall hybrid, defined by the Hyb format

SEGMENT_COLUMNS = ('ref_name', 'read_start', 'read_end', 'ref_start', 'ref_end', 'score')

Record columns 4-9 and 10-15, respectively, defining annotated parameters of seg1 and seg2 respectively, defined by the Hyb format

ALL_FLAGS = ('count_total', 'count_last_clustering', 'two_way_merged', 'seq_IDs_in_cluster', 'read_count', 'orient', 'det', 'seg1_type', 'seg2_type', 'seg1_det', 'seg2_det', 'miRNA_seg', 'target_reg', 'ext', 'dataset')

Flags defined by the hybkit package. Flags 1-4 are utilized by the Hyb software package. For information on flags, see the Flags portion of the hybkit Hyb File Specification.

settings = {'allow_undefined_flags': False, 'allow_unknown_seg_types': False, 'custom_flags': [], 'hyb_placeholder': '.', 'mirna_types': ['miRNA', 'microRNA'], 'reorder_flags': True}

Class-level settings. See settings.HybRecord_settings_info for descriptions.

TypeFinder

Link to type_finder.TypeFinder class for parsing sequence identifiers in assigning segment types by eval_types().

SET_PROPS = ('energy', 'full_seg_props', 'fold_record', 'eval_types', 'eval_mirna', 'eval_target')

Properties for the is_set() method.

GEN_PROPS = ('has_indels',)

General record properties for the prop() method.

  • has_indels : either seg1 or seg2 alignments has insertions/deletions, shown by differing read/reference length for the same alignment

STR_PROPS = ('id_is', 'id_prefix', 'id_suffix', 'id_contains', 'seq_is', 'seq_prefix', 'seq_suffix', 'seq_contains', 'seg1_is', 'seg1_prefix', 'seg1_suffix', 'seg1_contains', 'seg2_is', 'seg2_prefix', 'seg2_suffix', 'seg2_contains', 'any_seg_is', 'any_seg_prefix', 'any_seg_suffix', 'any_seg_contains', 'seg1_type_is', 'seg1_type_prefix', 'seg1_type_suffix', 'seg1_type_contains', 'seg2_type_is', 'seg2_type_prefix', 'seg2_type_suffix', 'seg2_type_contains', 'any_seg_type_is', 'any_seg_type_prefix', 'any_seg_type_suffix', 'any_seg_type_contains')

String-comparison properties for the prop() method.

MIRNA_PROPS = ('has_mirna', 'no_mirna', 'mirna_dimer', 'mirna_not_dimer', '5p_mirna', '3p_mirna')

miRNA-evaluation-related properties for the prop() method. Requires miRNA_seg flag to be set by eval_mirna() method.

  • has_mirna : Either or Both Seg1 or seg2 hve been identified as a miRNA

  • no_mirna : Both Seg1 and seg2 have been identified as Not a miRNA

  • mirna_dimer : Both seg1 and seg2 have been identified as a miRNA

  • mirna_not_dimer : One and Only One of seg1 or seg2 has been identified as a miRNA

  • 5p_mirna : Seg1 (5p) has been identified as a miRNA

  • 3p_mirna : Seg2 (3p) has been identified as a miRNA

MIRNA_STR_PROPS = ('mirna_is', 'mirna_prefix', 'mirna_suffix', 'mirna_contains', 'target_is', 'target_prefix', 'target_suffix', 'target_contains', 'mirna_seg_type_is', 'mirna_seg_type_prefix', 'mirna_seg_type_suffix', 'mirna_seg_type_contains', 'target_seg_type_is', 'target_seg_type_prefix', 'target_seg_type_suffix', 'target_seg_type_contains')
  • Comparisons:

  • is : Comparison string matches field exactly

  • prefix : Comparison string matches beginning of field

  • suffix : Comparison string matches end of field

  • contains : Comparison string is contained within field

HAS_PROPS = ('has_indels', 'id_is', 'id_prefix', 'id_suffix', 'id_contains', 'seq_is', 'seq_prefix', 'seq_suffix', 'seq_contains', 'seg1_is', 'seg1_prefix', 'seg1_suffix', 'seg1_contains', 'seg2_is', 'seg2_prefix', 'seg2_suffix', 'seg2_contains', 'any_seg_is', 'any_seg_prefix', 'any_seg_suffix', 'any_seg_contains', 'seg1_type_is', 'seg1_type_prefix', 'seg1_type_suffix', 'seg1_type_contains', 'seg2_type_is', 'seg2_type_prefix', 'seg2_type_suffix', 'seg2_type_contains', 'any_seg_type_is', 'any_seg_type_prefix', 'any_seg_type_suffix', 'any_seg_type_contains', 'has_mirna', 'no_mirna', 'mirna_dimer', 'mirna_not_dimer', '5p_mirna', '3p_mirna', 'mirna_is', 'mirna_prefix', 'mirna_suffix', 'mirna_contains', 'target_is', 'target_prefix', 'target_suffix', 'target_contains', 'mirna_seg_type_is', 'mirna_seg_type_prefix', 'mirna_seg_type_suffix', 'mirna_seg_type_contains', 'target_seg_type_is', 'target_seg_type_prefix', 'target_seg_type_suffix', 'target_seg_type_contains')

All allowed properties for the prop() method. See GEN_PROPS, STR_PROPS, MIRNA_PROPS, and MIRNA_STR_PROPS

set_flag(flag_key: str, flag_val: Optional[Union[float, int, str, bool]], allow_undefined_flags: Optional[bool] = None) None

Set the value of record flag_key to flag_val.

Parameters
get_seg1_type(require: bool = False) Optional[str]

Return the seg1_type flag if defined, or return None.

Parameters

require -- If True, raise an error if seg1_type is not defined.

get_seg2_type(require: bool = False) Optional[str]

Return the seg2_type flag if defined, or return None.

Parameters

require (bool, optional) -- If True, raise an error if seg2_type is not defined.

get_seg_types(require: bool = False) Tuple[Optional[str], Optional[str]]

Return "seg1_type" (or None), "seg2_type" (or None) flags.

Return a tuple of the seg1_type and seg2_type flags for each respective flag that is defined, or None for each flag that is not.

Parameters

require (bool, optional) -- If True, raise an error if either flag is not defined.

get_read_count(require: bool = False) Optional[int]

Return the read_count flag if defined, otherwise return None.

Parameters

require (bool, optional) -- If True, raise an error if the "read_count" flag is not defined.

get_record_count(require: bool = False) int

Return count_total flag if defined, or return 1 (this record).

Parameters

require (bool, optional) -- If True, raise an error if the "count_total" flag is not defined.

get_mirna_props(allow_mirna_dimers: bool = False, require: bool = True) Optional[Dict]

Return the seg_props dict corresponding to the miRNA segment, if set.

If eval_mirna() has been run, return the seg_props dict corresponding to the miRNA segment type as determined by checking the miRNA_seg flag, or None if the record does not contain a miRNA.

Parameters
  • allow_mirna_dimers (bool, optional) -- If True, consider miRNA dimers as a miRNA/target pair and return the 5p miRNA segment properties.

  • require (bool, optional) -- If True, raise an error if the read does not contain a miRNA-annotated segment (Default: True).

get_target_props(allow_mirna_dimers: bool = False, require: bool = True) Optional[Dict]

Return the seg_props dict corresponding to the target segment, if set.

If eval_mirna() has been run, return the seg_props dict corresponding to the target segment type as determined by checking the miRNA_seg flag, (and returning the other segment), or None if the record does not contain a miRNA or contains two miRNAs.

Parameters
  • allow_mirna_dimers (bool, optional) -- If True, consider miRNA dimers as a miRNA/target pair and return the 3p miRNA segment properties as the arbitrarily-selected "target" of the dimer pair.

  • require (bool, optional) -- If True, raise an error if the read does not contain a single target-annotated segment (Default: True).

eval_types(allow_unknown: Optional[bool] = None) None

Find the types of each segment using the the TypeFinder class.

This method provides HybRecord.seg1_props and HybRecord.seg2_props to the TypeFinder class, linked as attribute HybRecord.TypeFinder. This uses the method: TypeFinder.find set by TypeFinder.set_method or TypeFinder.set_custom_method to set the seg1_type, seg2_type flags if not already set.

To use a type-finding method other than the default, prepare the TypeFinder class by preparing and setting TypeFinder.params and using TypeFinder.set_method.

Parameters

allow_unknown (bool, optional) -- If True, allow segment types that cannot be identified and set them as "unknown". Otherwise raise an error. If not provided uses setting in settings['allow_unknown_seg_types'].

set_fold_record(fold_record: Union[FoldRecord, Tuple[FoldRecord, Any]], allow_energy_mismatch: bool = False) None

Check and set provided fold_record (FoldRecord) as attribute fold_record.

Ensures that fold_record argument is an instance of FoldRecord and has a matching sequence to this HybRecord, then set as HybRecord.fold_record.

Parameters
eval_mirna(override: bool = False, mirna_types: Optional[bool] = None) None

Analyze and set miRNA properties from type properties in the hyb record.

If not already done, determine whether a miRNA exists within this record and set the miRNA_seg flag. This evaluation requires the seg1_type and seg2_type flags to be populated, which can be performed by the eval_types() method.

Parameters
  • override (bool, optional) -- If True, override existing miRNA_seg flag if present.

  • mirna_types (list, tuple, or set, optional) -- Iterable of string representing sequence types considered as miRNA. Otherwise, the types are used from settings['mirna_types'] (it is suggested that this be provided as a set for fastest checking).

mirna_details(detail: Literal['all', 'mirna_ref', 'target_ref', 'mirna_seg_type', 'target_seg_type', 'mirna_seq', 'target_seq', 'mirna_fold', 'target_fold'] = 'all', allow_mirna_dimers: bool = False) Optional[Union[Dict, str]]

Provide a detail about the miRNA or target following eval_mirna().

Analyze miRNA properties within the sequence record and provide a detail as output. Unless allow_mirna_dimers is True, this method requires record to contain a non-dimer miRNA, otherwise an error will be raised.

Parameters
  • detail (str) --

    Type of detail to return. Options include:
    all : Dict of all properties (default)
    mirna_ref : Identifier for Assigned miRNA
    target_ref : Identifier for Assigned Target
    mirna_seg_type : Assigned seg_type of miRNA
    target_seg_type : Assigned seg_type of target
    mirna_seq : Annotated subsequence of miRNA
    target_seq : Annotated subsequence of target
    mirna_fold : Annotated fold substring of miRNA (requires fold_record set)
    target_fold : Annotated fold substring of target (requires fold_record set)

  • allow_mirna_dimers (bool, optional) -- Allow miRNA/miRNA dimers. The 5p-position will be assigned as the "miRNA", and the 3p-position will be assigned as the "target".

mirna_detail(*args, **kwargs)

Deprecate, alias for mirna_details().

Deprecated since version v0.3.0.

is_set(prop: str) bool

Return True if HybRecord property "prop" is set (if relevant) and is not None.

Options described in SET_PROPS.

Parameters

prop (str) -- Property / Analysis to check

not_set(prop: str) bool

Return False if HybRecord property "prop" is set (if relevant) and is not None.

( returns not is_set(prop) )

Parameters

prop (str) -- Property / Analysis to check

prop(prop: str, prop_compare: Optional[str] = None) bool

Return True if HybRecord has property: prop.

Check property against list of allowed properties in HAS_PROPS. If query property has a string comparator, provide this in prop_compare. Raises an error if a prerequisite field is not set (use is_set() to check whether properties are set).

Specific properties available to check are described in attributes:

GEN_PROPS

General Record Properties

STR_PROPS

Field String Comparison Properties

MIRNA_PROPS

miRNA-Associated Record Properties

MIRNA_STR_PROPS

miRNA-Associated String Comparison Properties

Parameters
  • prop (str) -- Property to check

  • prop_compare (str, optional) -- Comparator to check.

has_prop(*args, **kwargs)

Return True if HybRecord has property: prop.

Deprecated since version v0.3.0: Use prop() instead.

to_line(newline: bool = True, sep: str = '\t') str

Return a hyb-format string representation of the record.

Parameters
  • newline (bool, optional) -- Terminate returned string with a newline (default: True)

  • sep (str, optional) -- Separator between fields (Default: "\t")

to_csv(newline: bool = False) str

Return a comma-separated hyb-format string representation of the record.

Parameters

newline (bool, optional) -- If True, end the returned string with a newline.

to_fields(missing_obj: Optional[Union[float, int, str, bool]] = None) dict

Return a python dictionary representation of the record.

Returns a dictionary with keys corresponding to the fields in the hyb-format file, and values corresponding to the values in the record. Output can be used with the pandas DataFrame constructor or csv.DictWriter.

Parameters

missing_obj (optional) -- Object to use for missing values. Default = None.

to_fasta_record(mode: Literal['hybrid', 'seg1', 'seg2', 'mirna', 'target'] = 'hybrid', annotate: bool = True, allow_mirna_dimers: bool = False) None

Return nucleotide sequence as BioPython SeqRecord object.

Parameters
  • mode (str, optional) --

    Determines which sequence component to return. Options:
    hybrid: Entire hybrid sequence (default)
    seg1: Sequence 1 (if defined)
    seg2: Sequence 2 (if defined)
    miRNA: miRNA sequence of miRNA/target pair (if defined, else None)
    target: Target sequence of miRNA/target pair (if defined, else None)

  • annotate (bool, optional) -- Add name of components to fasta sequence identifier if present.

  • allow_mirna_dimers (bool, optional) --

    If True, allow miRNA dimers to be
    returned as miRNA sequence (the 5p segment
    will be selected as the "miRNA").

to_fasta_str(mode: Literal['hybrid', 'seg1', 'seg2', 'mirna', 'target'] = 'hybrid', annotate: bool = True) str

Return nucleotide sequence as a fasta string.

Parameters
  • mode (str, optional) --

    as with to_fasta_record() method.

  • annotate (bool, optional) -- Add name of components to fasta sequence identifier if present.

classmethod from_line(line: str, hybformat_id: bool = False, hybformat_ref: bool = False) Self

Construct a HybRecord instance from a single-line hyb-format string.

The Hyb software package ([Travis2014]) records read-count information in the "id" field of the record, which can be read by setting hybformat_id=True. Additionally, the Hyb hOH7 database contains the segment type in the identifier of each reference in the 4th field, which can be read by setting hybformat_ref=True.

Parameters
  • line (str) -- hyb-format string containing record information.

  • hybformat_id (bool, optional) -- If True, read count information from identifier in <read_number>_<read_count> format.

  • hybformat_ref (bool, optional) -- If True, read additional record information from identifier in <gene_id>_<transcript_id>_<gene_name>_<seg_type> format.

Returns

HybRecord instance containing record information.

classmethod from_fasta_records(seg1_record: None, seg2_record: None, hyb_id: Optional[str] = None, energy: Optional[Union[float, int, str]] = None, flags: Optional[Dict[str, Any]] = None) Self

Construct a HybRecord instance from two BioPython SeqRecord Objects.

Create artificial HybRecord from two SeqRecord Objects For the hybrid:

id: [seg1_record.id]--[seg2_record.id] (overwritten by "id" parameter if provided)
seq: seg1_record.seq + seg2_record

For each segment:

FASTA_Sequence_ID -> segN_ref_name
FASTA_Description -> Flags: segN_det (Overwritten if segN_det flag is provided directly)

Optional fields to add via function arguments:

hyb_id
energy
flags
Parameters
  • seg1_record (SeqRecord) -- Biopython SeqRecord object containing information on the left/first/5p hybrid segment (seg1)

  • seg2_record (SeqRecord) -- Biopython SeqRecord object containing information on the right/second/3p hybrid segment (seg2)

  • hyb_id (str, optional) -- Identifier for the hyb record (overwrites generated id if provided)

  • energy (str or float, optional) -- Predicted energy of sequence folding in kcal/mol

  • flags (dict, optional) -- Dict with keys of flags for the record and their associated values. Any flags provided overwrite default-generated flags.

Returns

HybRecord instance containing record information.

classmethod to_fields_header() Literal['id', 'seq', 'energy', 'seg1_ref_name', 'seg1_read_start', 'seg1_read_end', 'seg1_ref_start', 'seg1_ref_end', 'seg1_score', 'seg2_ref_name', 'seg2_read_start', 'seg2_read_end', 'seg2_ref_start', 'seg2_ref_end', 'seg2_score', 'flags']

Return a list of the fields in a HybRecord object.

For use with the to_fields() method.

classmethod to_csv_header(newline: bool = False) Literal['id,seq,energy,seg1_ref_name,seg1_read_start,seg1_read_end,seg1_ref_start,seg1_ref_end,seg1_score,seg2_ref_name,seg2_read_start,seg2_read_end,seg2_ref_start,seg2_ref_end,seg2_score,flags']

Return a comma-separated string representation of the fields in the record.

For use with the to_csv() method.

Parameters

newline (bool, optional) -- If True, end the returned string with a newline.

HybFile Class

class hybkit.HybFile(path: str, *args: Any, hybformat_id: Optional[bool] = None, hybformat_ref: Optional[bool] = None, from_file_like: bool = False, **kwargs: Any)

Wrapper for a hyb-format text file which returns entries (lines) as HybRecord objects.

Parameters
  • path (str) -- Path to text file to open as hyb-format file.

  • *args -- Arguments passed to open() function to open a text file for reading/writing.

  • hybformat_id (bool, optional) -- If True, during parsing of lines read count information from identifier in <read_number>_<read_count> format. Defaults to value in settings['hybformat_id'].

  • hybformat_ref (bool, optional) -- If True, during parsing of lines read additional record information from identifier in <gene_id>_<transcript_id>_<gene_name>_<seg_type> format. Defaults to value in settings['hybformat_ref'].

  • from_file_like (bool, optional) -- If True, the first argument is treated as a file-like object (such as io.StringIO or gzip.GzipFile) and the remaining positional arguments are ignored. (Default False``)

  • **kwargs -- Keyword arguments passed to open() function to open a text file for reading/writing.

Variables
  • hybformat_id (bool) -- Read count information from identifier during line parsing

  • hybformat_ref (bool) -- Read type information from reference name during line parsing

  • fh (file) -- Underlying file handle for the HybFile object.

settings = {'hybformat_id': False, 'hybformat_ref': False}

Class-level settings. See hybkit.settings.HybFile_settings_info for descriptions.

close() None

Close the file.

read_record() str

Return next line of hyb file as HybRecord object.

read_records() List[str]

Return list of all (remaining) records in hyb file as HybRecord objects.

write_record(write_record: HybRecord) None

Write a HybRecord object to file as a Hyb-format string.

Unlike the file.write() method, this method will add a newline to the end of each written record line.

Parameters

write_record (HybRecord) -- Record to write.

write_records(write_records: Iterable[HybRecord]) None

Write a sequence of HybRecord objects as hyb-format lines to the Hyb file.

Unlike the file.writelines() method, this method will add a newline to the end of each written record line.

Parameters

write_records (list) -- List of HybRecord objects to write.

write_fh(*args, **kwargs) None

Write directly to the underlying file handle.

write(*_args, **_kwargs) None

Implement no-op / error for "write" method to catch errors.

Use write_record() or write_fh() instead.

classmethod open(path: str, *args: Any, hybformat_id: Optional[bool] = None, hybformat_ref: Optional[bool] = None, **kwargs: Any) Self

Open a path to a text file using open() and return a HybFile object.

Arguments match those of the Python3 built-in open() function and are passed directly to it.

This method is provided as a convenience function for drop-in replacement of the built-in open() function.

Specific keyword arguments are provided for HybFile-specific settings:

Parameters
  • path (str) -- Path to file to open.

  • hybformat_id (bool, optional) -- If True, during parsing of lines read count information from identifier in <read_number>_<read_count> format. Defaults to value in settings['hybformat_id'].

  • hybformat_ref (bool, optional) -- If True, during parsing of lines read additional record information from identifier in <gene_id>_<transcript_id>_<gene_name>_<seg_type> format. Defaults to value in settings['hybformat_ref'].

Example usage:
with HybFile.open('path/to/file.hyb', 'r') as hyb_file:
    for record in hyb_file:
        print(record)
Parameters
  • *args -- Passed directly to open().

  • **kwargs -- Passed directly to open().

Returns

HybFile object.

FoldRecord Class

class hybkit.FoldRecord(id: str, seq: str, fold: str, energy: Optional[Union[float, int, str]] = None, seq_type: Optional[Literal['static', 'dynamic']] = None)

Class for storing secondary structure (folding) information for a nucleotide sequence.

This class supports the following file types: (Data courtesy of [Gay2018])

  • The ".vienna" file format used by the ViennaRNA package ([ViennaFormat]; [Lorenz2011]):
    Example:
    34_151138_MIMAT0000076_MirBase_miR-21_microRNA_1_19-...
    TAGCTTATCAGACTGATGTTAGCTTATCAGACTGATG
    .....((((((.((((((......)))))).))))))   (-11.1)
    
  • The ".ct" file format used by UNAFold and other packages ([CTFormat], [Zuker2003]):
    Example:
    41        dG = -8 dH = -93.9      seq1_name-seq2_name
    1 A       0       2       0       1       0       0
    2 G       1       3       0       2       0       0
    ...
    ...
    ...
    40        G       39      41      11      17      39      41
    41        T       40      0       10      18      40      0
    

A minimum amount of data necessary for a FoldRecord object is a sequence identifier, a genomic sequence, and its fold representation.

Two types of FoldRecord objects are supported, 'static' and 'dynamic'. Static FoldRecord objects are those where the 'seq' attribute matches exactly to the corresponding HybRecord.seq attribute (where applicable). Dynamic FoldRecord objects are those where FoldRecord.seq is reconstructed from aligned regions of a HybRecord.seq chimeric read: Longer for chimeras with overlapping alignments, shorter for chimeras with gapped alignments.

Overlapping Alignment Example:

Static:
seg1: 1111111111111111111111
seg2:                   222222222222222222222
seq:  TAGCTTATCAGACTGATGTTTTAGCTTATCAGACTGATG

Dynamic:
seg1: 1111111111111111111111
seg2:                       222222222222222222222
seq:  TAGCTTATCAGACTGATGTTTTTTTTAGCTTATCAGACTGATG

Gapped Alignment Example:

Static:
seg1:   1111111111111111
seg2:                     222222222222222222
seq:  TTAGCTTATCAGACTGATGTTAGCTTATCAGACTGATG

Dynamic:
seg1: 1111111111111111
seg2:                 222222222222222222
seq:  AGCTTATCAGACTGATTAGCTTATCAGACTGATG

Dynamic sequences are found in the Hyb program *_hybrids_ua.hyb file type. This is primarily relevant in error-checking when setting the HybRecord.set_fold_record() method.

When the 'static' FoldRecord type is used, the following methods are used for HybRecord.fold_record error-checking:

When the 'dynamic' FoldRecord type is used, the following methods are used for HybRecord.fold_record error-checking:

Parameters
Variables
  • id (str) -- Sequence Identifier (often seg1name-seg2name)

  • seq (str) -- Genomic Sequence

  • fold (str) -- Dot-bracket Fold Representation, '(', '.', and ')' characters

  • energy (str) -- Predicted energy of folding

  • seq_type (str) -- Whether sequence is 'static' or 'dynamic' (Default: 'static'; see Args for details)

settings = {'allowed_mismatches': 0, 'error_mode': 'raise', 'fold_placeholder': '.', 'seq_type': 'static'}

Class-level settings. See hybkit.settings.FoldRecord_settings_info for descriptions.

to_vienna_lines(newline: bool = True) List[str]

Return a list of lines for the record in vienna format.

See (Vienna File Format).

Parameters

newline (bool, optional) -- Add newline character to the end of each returned line. (Default: True)

to_vienna_string(newline: bool = True) str

Return a 3-line string for the record in vienna format.

See (Vienna File Format).

Parameters

newline (bool, optional) -- Terminate the returned string with a newline character. (Default: True)

count_hyb_record_mismatches(hyb_record: HybRecord) int

Count mismatches between hyb_record.seq and fold_record.seq.

Uses static_count_hyb_record_mismatches() if seq_type is static, or dynamic_count_hyb_record_mismatches() if seq_type is dynamic.

Parameters

hyb_record (HybRecord) -- hyb_record for comparison.

static_count_hyb_record_mismatches(hyb_record: HybRecord) int

Count mismatches between hyb_record.seq and fold_record.seq.

Parameters

hyb_record (HybRecord) -- hyb_record for comparison.

dynamic_count_hyb_record_mismatches(hyb_record: HybRecord) int

Count mismatches between hyb_record.seq and dynamic fold_record.seq.

Parameters

hyb_record (HybRecord) -- hyb_record for comparison

matches_hyb_record(hyb_record: HybRecord, allowed_mismatches: Optional[int] = None) bool

Return True if self.seq and hyb_record.seq mismatches are <= allowed_mismatches.

Parameters
ensure_matches_hyb_record(hyb_record: HybRecord, allowed_mismatches: Optional[int] = None) None

Ensure self.seq matches hyb_record.seq, else raise an error.

Parameters
classmethod from_vienna_lines(record_lines: List[str], error_mode: Optional[Literal['raise', 'warn_return', 'return']] = None, seq_type: Optional[Literal['static', 'dynamic']] = None) Union[Tuple[None, str], Tuple[Literal['NOFOLD'], str], Tuple[Literal['NOENERGY'], str], Self]

Construct instance from a list of 3 strings of vienna-format ([ViennaFormat]) lines.

See Vienna File Format for more details.

Parameters

record_lines (list or tuple) -- Iterable of 3 strings corresponding to lines of a vienna-format record.

classmethod from_vienna_string(record_string: str, error_mode: Optional[Literal['raise', 'warn_return', 'return']] = None, seq_type: Optional[Literal['static', 'dynamic']] = None) Union[Tuple[None, str], Tuple[Literal['NOFOLD'], str], Tuple[Literal['NOENERGY'], str], Self]

Construct instance from a string representing 3 vienna-format ([ViennaFormat]) lines.

See Vienna File Format for more details.

Parameters

record_string (str or tuple) -- 3-line string containing a vienna-format record

classmethod from_ct_lines(record_lines: List[str], error_mode: Optional[Literal['raise', 'warn_return', 'return']] = None, seq_type: Optional[Literal['static', 'dynamic']] = None) Union[Tuple[None, str], Tuple[Literal['NOFOLD'], str], Tuple[Literal['NOENERGY'], str], Self]

Create a FoldRecord from a list of record lines in ".ct" format ([CTFormat]).

See CT File Format for more details.

Warning

This method is in beta stage, and is not well-tested.

Parameters

record_lines (list or tuple) -- list containing lines of ct record

classmethod from_ct_string(record_string: str, error_mode: Optional[Literal['raise', 'warn_return', 'return']] = None, seq_type: Optional[Literal['static', 'dynamic']] = None) Union[Tuple[None, str], Tuple[Literal['NOFOLD'], str], Tuple[Literal['NOENERGY'], str], Self]

Create a FoldRecord entry from a multi-line string from ".ct" format ([CTFormat]).

See CT File Format for more details.

Warning

This method is in beta stage, and is not well-tested.

Parameters

record_string (str) -- String containing lines of ct record

ViennaFile Class

class hybkit.ViennaFile(*args: Any, seq_type: Optional[Literal['static', 'dynamic']] = None, error_mode: Optional[Literal['raise', 'warn_return', 'return']] = None, from_file_like: bool = False, **kwargs: Any)

Vienna file wrapper that returns vienna-format file lines as FoldRecord objects.

See Vienna File Format for more information.

Parameters
  • seq_type (str, optional) -- Type of FoldRecord to return: static, or dynamic (if not provided, uses FoldRecord.settings['seq_type']).

  • error_mode (str, optional) -- String representing the error mode. If None, defaults to the value set in settings['error_mode']. Options: "raise": Raise an error when encountered and exit program; "warn_return": Print a warning and return the error_value; "return": Return the error value with no warnings.

  • from_file_like (bool, optional) -- If True, treat the first argument as a file-like object (such as io.StringIO or gzip.GzipFile) and the remaining positional arguments are ignored (Default False).

  • *args -- Passed to open().

  • **kwargs -- Passed to open().

Variables
  • fh (file) -- File handle for the file being wrapped.

  • foldrecord_seq_type (str) -- Type of FoldRecord to return (see Args)

  • error_mode (str) -- Mode for error catching (see Args)

Warning

Occasionally fold files can be poorly-formatted. In that case, this iterator attempts error-catching but this is not always successful so verbose error modes are encouraged.

read_record(override_error_mode: Optional[Literal['raise', 'warn_return', 'return']] = None) Union[Tuple[None, str], Tuple[Literal['NOFOLD'], str], Tuple[Literal['NOENERGY'], str], Self]

Read next three lines and return output as FoldRecord object.

Parameters

override_error_mode (str) -- Override the error_mode set in the ViennaFile object. See the ViennaFile Constructor for more information on allowed error modes.

close() None

Close the file handle.

classmethod open(path: str, *args: Any, **kwargs: Any) Self

Open a path to a text file using open() and return relevant file object.

Arguments match those of the Python3 built-in open() function and are passed directly to it.

This method is provided as a convenience function for drop-in replacement of the built-in open() function.

Specific keyword arguments are provided for fold-file-specific settings:

Parameters
  • path (str) -- Path to file to open.

  • seq_type (str, optional) -- Type of FoldRecord to return: static, or dynamic (if not provided, uses FoldRecord.settings['seq_type']).

  • error_mode (str, optional) -- String representing the error mode. If None, defaults to the value set in settings['error_mode']. Options: "raise": Raise an error when encountered and exit program; "warn_return": Print a warning and return the error_value; "return": Return the error value with no warnings.

  • *args -- Passed directly to open().

  • **kwargs -- Passed directly to open().

Returns

HybFile object.

read_records() List[FoldRecord]

Return list of all FoldRecord objects for this file type.

settings = {}

Class-level settings. See hybkit.settings.FoldFile_settings_info for descriptions.

write_fh(*args: Any, **kwargs: Any) None

Write directly to the underlying file handle.

write_record(write_record: FoldRecord) None

Write a FoldRecord object for this file type.

Unlike the file.write() method, this method will add a newline to the end of each written record line.

Parameters

write_record (FoldRecord) -- FoldRecord objects to write.

write_records(write_records: Iterable[FoldRecord]) None

Write a sequence of FoldRecord objects for this file type.

Unlike the file.writelines() method, this method will add a newline to the end of each written record line.

Parameters

write_records (list) -- List of FoldRecord objects to write.

CtFile Class

class hybkit.CtFile(*args: Any, seq_type: Optional[Literal['static', 'dynamic']] = None, error_mode: Optional[Literal['raise', 'warn_return', 'return']] = None, from_file_like: bool = False, **kwargs: Any)

Ct file wrapper that returns ".ct" file lines as FoldRecord objects.

See CT File Format for more information.

Warning

This class is in beta stage, and is not well-tested.

Parameters
  • seq_type (str, optional) -- Type of FoldRecord to return: static, or dynamic (if not provided, uses FoldRecord.settings['seq_type']).

  • error_mode (str, optional) -- String representing the error mode. If None, defaults to the value set in settings['error_mode']. Options: "raise": Raise an error when encountered and exit program; "warn_return": Print a warning and return the error_value; "return": Return the error value with no warnings.

  • from_file_like (bool, optional) -- If True, treat the first argument as a file-like object (such as io.StringIO or gzip.GzipFile) and the remaining positional arguments are ignored (Default False).

  • *args -- Passed to open().

  • **kwargs -- Passed to open().

Variables
  • fh (file) -- File handle for the file being wrapped.

  • foldrecord_seq_type (str) -- Type of FoldRecord to return (see Args)

  • error_mode (str) -- Mode for error catching (see Args)

Warning

Occasionally fold files can be poorly-formatted. In that case, this iterator attempts error-catching but this is not always successful so verbose error modes are encouraged.

read_record() Union[Tuple[None, str], Tuple[Literal['NOFOLD'], str], Tuple[Literal['NOENERGY'], str], Self]

Return the next CT record as a FoldRecord object.

Call next(self.fh) to return the first line of the next entry. Determine the expected number of following lines in the entry, and read that number of lines further. Return lines as a FoldRecord object.

write_record = None

CtFile Record Writing Not Implemented

write_records = None

CtFile Record Writing Not Implemented

close() None

Close the file handle.

classmethod open(path: str, *args: Any, **kwargs: Any) Self

Open a path to a text file using open() and return relevant file object.

Arguments match those of the Python3 built-in open() function and are passed directly to it.

This method is provided as a convenience function for drop-in replacement of the built-in open() function.

Specific keyword arguments are provided for fold-file-specific settings:

Parameters
  • path (str) -- Path to file to open.

  • seq_type (str, optional) -- Type of FoldRecord to return: static, or dynamic (if not provided, uses FoldRecord.settings['seq_type']).

  • error_mode (str, optional) -- String representing the error mode. If None, defaults to the value set in settings['error_mode']. Options: "raise": Raise an error when encountered and exit program; "warn_return": Print a warning and return the error_value; "return": Return the error value with no warnings.

  • *args -- Passed directly to open().

  • **kwargs -- Passed directly to open().

Returns

HybFile object.

read_records() List[FoldRecord]

Return list of all FoldRecord objects for this file type.

settings = {}

Class-level settings. See hybkit.settings.FoldFile_settings_info for descriptions.

write_fh(*args: Any, **kwargs: Any) None

Write directly to the underlying file handle.

HybFoldIter Class

class hybkit.HybFoldIter(hybfile_handle: HybFile, foldfile_handle: FoldFile, combine: bool = False, iter_error_mode: Optional[Literal['raise', 'warn_return', 'warn_skip', 'skip', 'return']] = None)

Iterator for simultaneous iteration over a HybFile and FoldFile object.

This class provides an iterator to iterate through a HybFile and one of a ViennaFile, or CtFile simultaneously to return a HybRecord and FoldRecord.

Basic error checking / catching is performed based on the value of the ~settings['error_mode'] setting.

Parameters
Returns

(HybRecord, FoldRecord)

settings = {'error_checks': ['hybrecord_indel', 'foldrecord_nofold', 'max_mismatch', 'energy_mismatch'], 'iter_error_mode': 'warn_skip', 'max_sequential_skips': 100}

Class-level settings. See settings.HybFoldIter_settings_info for descriptions.

report() List[str]

Return a report of information from iteration.

print_report() None

Print a report of information from iteration.

hybkit.type_finder

hybkit TypeFinder Class.

This module contains the TypeFinder class to work with HybRecord to parse sequence identifiers to identify sequence type.

class hybkit.type_finder.TypeFinder

Class for parsing identifiers to identify sequence 'type'.

Designed to be used by the hybkit.HybRecord

Variables

params (dict) -- Stored parameters for string parsing, where applicable.

find_with_params = None

Placeholder for storing active method, set with set_method() (see set_method() for details).

params = None

Placeholder for parameters for active method, set with set_method() (see set_method() for details).

default_method = 'hybformat'

Default method assigned using check_set_method()

methods = {'hybformat': 'method_hybformat', 'id_map': 'method_id_map', 'string_match': 'method_string_match'}

Dict of provided methods available to assign segment types

'hybformat'

method_hybformat()

'string_match'

method_string_match()

'id_map'

method_id_map()

param_methods = {'hybformat': None, 'id_map': 'make_id_map_params', 'string_match': 'make_string_match_params'}

Dict of param generation methods for type finding methods

'hybformat'

'N/A'

'string_match'

make_string_match_params()

'id_map'

make_id_map_params()

param_methods_needs_file = {'hybformat': False, 'id_map': True, 'string_match': True}

Dict of whether parameter generation methods need an input file

'hybformat'

False

'string_match'

True

'id_map'

True

classmethod set_method(method: str, params: Optional[Dict[str, Any]] = None) None

Select method to use when finding types.

Available methods are listed in methods.

Parameters
  • method (str) -- Method option from methods to set for use as find().

  • params (dict, optional) -- Dict object of parameters to use by set method.

classmethod method_is_set() bool

Return whether a TypeFinder method has been set.

Methods should be set with set_method().

Returns

True if a method has been set, False otherwise.

Return type

bool

classmethod check_set_method() None

If no TypeFinder method set, set as default_method.

classmethod find(seg_props: Dict[str, Union[float, int, str]]) Optional[str]

Find type of segment using TypeFinder.find_custom_method().

If a TypeFinder method has been set with set_method(). use the current parameters set in params to find the type of the provided segment by calling:

seg_type = :meth:`TypeFinder.find_custom_method`(seg_props, :attr`TypeFinder.params`)
Parameters

seg_props (dict) -- seg_props from hybkit.HybRecord

Returns

Type of the provided segment, or None if a type cannot be identified.

Return type

str

classmethod set_custom_method(method: Callable, params: Optional[dict] = None) None

Set the method for use to find seg types.

This method is for providing a custom function. To use the included functions, use set_method(). Custom functions provided must have the signature:

seg_type = custom_method(self, seg_props, params)

This function should return the string of the assigned segment type if found, or a None object if the type cannot be found. It can also take a dictionary in the "params" argument that specifies additional or dynamic search properties, as desired.

Parameters
  • method (method) -- Method to set for use.

  • params (dict, optional) -- dict of custom parameters to set for use.

static method_hybformat(seg_props: Dict[str, Union[float, int, str]], params: Optional[dict] = None) Optional[str]

Return the type of the provided segment, or None if segment cannot be identified.

This method works with sequence / alignment mapping identifiers in the format of the reference database provided by the Hyb Software Package, specifically identifiers of the format:

<gene_id>_<transcript_id>_<gene_name>_<seg_type>

This method returns the last component of the identifier, split by "_", as the identified sequence type. (returns None if the segment identifier does not contain "_").

Example

"MIMAT0000076_MirBase_miR-21_microRNA"  --->  "microRNA".
Parameters
static method_string_match(seg_props: Dict[str, Union[float, int, str]], params: Optional[dict] = None) Optional[str]

Return the type of the provided segment, or None if unidentified.

This method attempts to find a string matching a specific pattern within the identifier of the aligned segment. Search options include "startswith", "contains", "endswith", and "matches", and returns the first type matching the criteria. The required params dict should contain a key for each desired search type, with a list of 2-tuples for each search-string with assigned-type.

Example

params = {'endswith': [('_miR', 'microRNA'),
                       ('_trans', 'mRNA')   ]}

This dict can be generated with the associated make_string_match_params() method and an associated csv legend file with format:

#comment line
#search_type,search_string,seg_type
endswith,_miR,microRNA
endswith,_trans,mRNA
Parameters
  • seg_props (dict) -- HybRecord segment properties dict to evaluate.

  • params (dict, optional) -- Dict with search parameters as described above.

static make_string_match_params(legend_file: str) dict

Read csv and return a dict of search parameters for method_string_match().

The my_legend.csv file should have the format:

#comment line
#search_type,search_string,seg_type
endswith,_miR,microRNA
endswith,_trans,mRNA

Search_type options include "startswith", "contains", "endswith", and "matches" The produced dict object contains a key for each search type, with a list of 2-tuples for each search-string and associated segment-type.

For example:

{'endswith': [('_miR', 'microRNA'),
              ('_trans', 'mRNA')   ]}
static method_id_map(seg_props: Dict[str, Union[float, int, str]], params: Optional[dict] = None) Optional[str]

Return the type of the provided segment or None if it cannot be identified.

This method checks to see if the identifier of the segment is present in the params dict. params should be formatted as a dict with keys as sequence identifier names, and the corresponding type as the respective values.

Example

params = {'MIMAT0000076_MirBase_miR-21_microRNA': 'microRNA',
          'ENSG00000XXXXXX_NR003287-2_RN28S1_rRNA': 'rRNA'}

This dict can be generated with the associated make_id_map_params() method.

Parameters
  • seg_props (dict) -- HybRecord segment properties dict to evaluate.

  • params (dict) -- Dict of mapping of sequence identifiers to sequence types.

Returns

Identified sequence type, or None if it cannot be found.

Return type

str

static make_id_map_params(mapped_id_files: List[str]) dict

Read file(s) into a mapping of sequence identifiers.

This method reads one or more files into a dict for use with the method_id_map() method. The method requires passing a file path (or list/tuple of file paths) of mapped_id_files. Files listed in the mapped_id_files argument should have the format:

#comment line
#seg_id,seg_type
segA_unique_id,segA_type
segB_unique_id,segB_type
Parameters

mapped_id_files (str, list, or tuple) -- Iterable object containing strings of paths to files containing id/type mapping information.

hybkit.analysis

Functions for analysis of HybRecord and FoldRecord objects.

Analysis

class hybkit.analysis.Analysis(analysis_types: Union[Literal['energy', 'type', 'mirna', 'target'], List[Literal['energy', 'type', 'mirna', 'target']]], name: Optional[str] = None, quant_mode: Optional[Literal['single', 'reads', 'records']] = None)

Class for analysis of hybkit HybRecord and FoldRecord objects.

This class contains multiple conceptual analyses for HybRecord/FoldRecord Data:

Energy: Analysis of values of predicted intra-hybrid folding energy
Type: Analysis of segment types
miRNA: Analysis of miRNA segments distributions
Target: Analysis of mirna target segment names and types
Fold: Analysis of folding data included in the analyzed hyb_records.

This class used by selecting the desired analysis types on object initialization. Analyses are performed either by using either the add_record() or the add_all_records() methods. The results of the analysis are then available through the get_all_results(), get_analysis_results(), get_specific_result(), and plot_analysis_results() methods, which can return (or plot) the results of all analyses or of a specific subset of analyses.

Details for each respective analysis are provided here:

Energy Analysis:

This analysis evaluates the energy of each HybRecord object and provides a binned-histogram of all energy values represented.

Output Results:
energy_analysis_count (int): Count of energy values evaluated
has_energy_val (int): Count of hyb_records with an energy value
no_energy_val (int): Count of hyb_records without an energy value
energy_min (float): Minimum energy value
energy_max (float): Maximum energy value
energy_mean (float): Mean energy value
energy_std (float): Standard deviation of energy values
binned_energy_vals (Counter): Counter with integer keys of energy values from energy_min to energy_max storing the count of any hyb_records with energy values that fall within that range (rounded to the next highest integer (e.g. -12.5 -> -12).

Type Analysis:

This analysis evaluates the counts of each type of segment included in the HybRecord objects. The types of segments are determined by the seg1_type and seg2_type flags, which are set by the hybkit.HybRecord.eval_types() method.

Requirements:

seg1_type and seg2_type flags must be set for each HybRecord, (can be done by hybkit.HybRecord.eval_types()).
Output Results:
types_analysis_count (int): Count of hybrid types analyzed
hybrid_types (Counter): Counter containing annotated types of seg1 and seg (in original 5p / 3p order)
reordered_hybrid_types (Counter): Counter containing annotated types of seg1 and seg2. This is provided in "sorted" order, where types are sorted alphabetically (independent of 5p / 3p position).
mirna_hybrid_types (Counter): Counter containing annotated types of seg1 and seg2. This is provided in "miRNA-prime" order, where a miRNA type is always listed before other types, and then remaining types are sorted alphabetically (independent of 5p / 3p position).
seg1_types (Counter): Counter containing annotated type of segment in position seg1
seg2_types (Counter): Counter containing annotated type of segment in position seg2
all_seg_types (Counter): Counter containing position-independent annotated types

miRNA Analysis:

Analysis of miRNA segments in hybrids.

The mirna_analysis provides an analysis of what miRNA types are present in the hyb records. If a miRNA dimer is present in a hybrid, this is counted in mirna_dimers. If a single miRNA is present in a hybrid, this is counted in mirnas_5p or mirnas_3p depending on the miRNA location.

Requirements:
mirna_seg flag must be set for each HybRecord (can be done by hybkit.HybRecord.eval_mirna()).
Output Results:
mirna_analysis_count (int): Count of miRNA hybrids analyzed
mirnas_5p (int): Count of 5p miRNAs detected
mirnas_3p (int): Count of 3p miRNAs detected
mirna_dimers (int): Count of miRNA dimers (5p + 3p) detected
non_mirna (int): Count of non-miRNA hybrids detected
has_mirna (int): Hybrids with 5p, 3p, or both as miRNA

Target Analysis:

Analysis of targets in miRNA-containing hybrids.

The target analysis provides an analysis of what annotated sequences and sequence types are targeted by any miRNA within the hyb records. If a miRNA is not present in a hybrid, the hybrid is not included in the analysis. If a miRNA dimer is present in a hybrid, the 5p miRNA is used for the analysis, and the 3p miRNA is considered the "target."

Requirements:
mirna_seg flag must be set for each HybRecord (can be done by hybkit.HybRecord.eval_mirna()).
Output Results:
target_analysis_count (int): Count of hybrids analyzed
target_evals (int): Count of target evaluations performed
target_names (Counter): Counter containing names of miRNA targets detected.
target_types (Counter): Counter containing types of miRNA targets detected.

Fold Analysis:

This analysis evaluates the predicted binding of miRNA within hyb records that contain a miRNA and have an associated FoldRecord object as the attribute fold_record. This includes an analysis and plotting of the predicted binding by position among the provided miRNA.

Requirements:
The mirna_seg flag must be set for each HybRecord (can be done by hybkit.HybRecord.eval_mirna()).
The fold_record attribute must be set for each HybRecord with a corresponding FoldRecord object. This can be done using the hybkit.HybRecord.set_fold_record() method.
Output Results:
fold_analysis_count (int): Count of miRNA fold predictions analyzed
folds_recorded (int): Count of fold predictions with a mirna fold
mirna_nt_fold_counts (Counter) : Counter with keys of miRNA position index and values of number of miRNAs with a predicted bound state at that index.
mirna_nt_fold_props (Counter) : Counter with keys of miRNA position index and values of proportion (0.0 - 1.0) of miRNAs with a predicted bound state at that index.
fold_match_counts (Counter) : Counter with keys of count of predicted matches between miRNA and target with values of count of miRNAs with that number of predicted matches.
Parameters
  • analysis_types (str or list of str) -- Analysis types to perform

  • name (str, optional) -- Name of the analysis

  • quant_mode (str, optional) -- Mode to use for record quantification. Options are "single": One count per record; "reads": If "read_count" flag is set, count all reads in record (else count 1); "records": if the "record_count" flag is set, count all individual records within combined record (else count 1). If not provided, defaults to the value in Analysis.settings['quant_mode'].

Variables
  • name (str) -- Name of the analysis

  • analysis_types (list of str) -- List of analysis types to perform

  • quant_mode (str) -- Mode to use for record quantification.

settings = {'out_delim': ',', 'quant_mode': 'single'}

Class-level settings. See hybkit.settings.Analysis_settings for descriptions.

analysis_options = ['energy', 'type', 'mirna', 'target', 'fold']
add_hyb_record(hyb_record: HybRecord) None

Add a HybRecord object to the analysis.

Parameters

hyb_record (HybRecord) -- HybRecord object to be added to the analysis.

add_hyb_records(hyb_records: List[HybRecord], eval_types: bool = False, eval_mirna: bool = False) None

Add a list of HybRecord objects to the analysis.

Parameters
get_all_results() dict

Return a dictionary with all results for all active analyses.

See Analyses for details on the results for each analysis type.

Returns

Dictionary with keys of analysis type and values of

dictionaries with results for that analysis type.

Return type

dict

get_analysis_results(analysis: Literal['energy', 'type', 'mirna', 'target']) Dict

Return a dictionary with all results for a specific analysis.

See Analyses for details on the results for each analysis type.

Parameters

analysis (str) -- Analysis type to return results for.

Returns

Dictionary with results for the specified analysis type.

see :ref:Analyses for details.

Return type

dict

get_specific_result(result_key: str) Any

Get a specific result from the analysis.

See Analyses for details on the results for each analysis type.

Parameters

result_key (str) -- Result key to return from one of the enabled analyses.

Returns

Result value for the specified result key.

get_analysis_delim_str(analysis: Optional[Literal['energy', 'type', 'mirna', 'target']] = None, out_delim: Optional[str] = None) str

Return a delimited string containing the results of the analysis.

See Analyses for details on the results for each analysis type.

Parameters
  • analysis (str or list of str) -- Analysis type for return results. If not provided, return the results for all active analyses.

  • out_delim (str) -- Delimiter to use for output. If not provided, defaults to the value in settings['out_delim'].

write_analysis_delim_str(out_file_name: Optional[str] = None, analysis: Optional[Union[Literal['energy', 'type', 'mirna', 'target'], List[Literal['energy', 'type', 'mirna', 'target']]]] = None, out_delim: Optional[str] = None) None

Write the results of the analysis to a delimited text file.

See Analyses for details on the results for each analysis type.

Parameters
  • out_file_name (str) -- Path to output file. If not provided, defaults to: ./<analysis_name>_<analysis>.csv if analysis/analyses provided, or ./<analysis_name>_multi_analysis.csv if no analysis/analyses provided.

  • analysis (str or list of str) -- Analysis type for return results. If not provided, return the results for all active analyses.

  • out_delim (str) -- Delimiter to use for output. If not provided, defaults to the value in settings['out_delim'].

write_analysis_results_special(out_basename: Optional[str] = None, analysis: Optional[Union[Literal['energy', 'type', 'mirna', 'target'], List[Literal['energy', 'type', 'mirna', 'target']]]] = None, out_delim: Optional[str] = None) List[str]

Write the results of the analyses to specialized text files.

See Analyses for details on the results for each analysis type.

Parameters
  • out_basename (str) -- Path for basename of output file. Files will be renamed using the provided path as the base name. If not provided, defaults to: ./<analysis_name>_<analysis> if name is set, or ./Analysis_multi_<analysis> if name not set.

  • analysis (str or list of str) -- Analysis type to write results files for. If not provided, write results files for all active analyses.

  • out_delim (str) -- Delimiter to use for output where applicable. If not provided, defaults to the value in settings['out_delim'].

plot_analysis_results(out_basename: Optional[str] = None, analysis: Optional[Union[Literal['energy', 'type', 'mirna', 'target'], List[Literal['energy', 'type', 'mirna', 'target']]]] = None) List[str]

Plot the results of the analyses.

See Analyses for details on the results for each analysis type.

Parameters
  • analysis (str or list of str) -- Analysis type to plot results for. If not provided, plot results for all active analyses.

  • out_basename (str) -- Path to output file. If not provided, defaults to: ./<analysis_name> if name provided or ./analysis if no name provided.

key = 'fold'

hybkit.plot

Methods for plotting analyses of HybRecord and FoldRecord objects.

hybkit.plot.COLOR_DICT = {'Blue': '#0072B2', 'Bluish Green': '#009E73', 'Orange': '#E69F00', 'Reddish Purple': '#CC79A7', 'Sky Blue': '#56B4E9', 'Vermilion': '#D55E00', 'Yellow': '#F0E442'}

Default Colors for colored plots: Colors selected based on "Points of view: Color blindness" by Bang Wong, Nature Methods, 2011. Colors in RGB nomenclature (1-255): Black (0,0,0), Orange (230,159,0), Sky Blue (86,180,233), Bluish Green (0,158,115), Yellow (240,228,66), Blue (0,114,178), Vermilion (213,94,0), Reddish Purple (204,121,167)

hybkit.plot.COLOR_LIST = ['#0072B2', '#D55E00', '#009E73', '#CC79A7', '#E69F00', '#56B4E9', '#F0E442']

List of default colors for colored plots.

hybkit.plot.ENERGY_HIST_RC_PARAMS = {'axes.labelweight': 'bold', 'axes.titlepad': 15, 'axes.titlesize': 'large', 'axes.titleweight': 'bold', 'figure.dpi': 1200, 'figure.figsize': [6.4, 4.8]}

Default mpl rcParams for energy analysis histograms.

hybkit.plot.TYPE_PIE_SINGLE_RC_PARAMS = {'axes.labelweight': 'bold', 'axes.titlepad': 15, 'axes.titleweight': 'bold', 'figure.dpi': 1200, 'figure.figsize': [6.4, 4.8]}

Default mpl rcParams for type analysis pie charts.

hybkit.plot.TYPE_PIE_DUAL_RC_PARAMS = {'axes.labelweight': 'bold', 'axes.titlepad': 15, 'axes.titleweight': 'bold', 'figure.dpi': 1200, 'figure.figsize': (8, 4.8)}

Default mpl rcParams for type analysis pie charts.

hybkit.plot.TARGET_PIE_RC_PARAMS = {'axes.labelweight': 'bold', 'axes.titlepad': 15, 'axes.titleweight': 'bold', 'figure.dpi': 1200, 'figure.figsize': (9.6, 4.8)}

Default mpl rcParams for target analysis pie charts.

hybkit.plot.FOLD_MATCH_HIST_RC_PARAMS = {'axes.labelweight': 'bold', 'axes.titlepad': 15, 'axes.titlesize': 'large', 'axes.titleweight': 'bold', 'figure.dpi': 1200, 'figure.figsize': [6.4, 4.8]}

Default mpl rcParams for fold match analysis histograms.

hybkit.plot.FOLD_NT_COUNTS_HIST_RC_PARAMS = {'axes.labelweight': 'bold', 'axes.titlepad': 15, 'axes.titlesize': 'large', 'axes.titleweight': 'bold', 'figure.dpi': 1200, 'figure.figsize': [6.4, 4.8]}

Default mpl rcParams for fold nt counts analysis histograms.

hybkit.plot.PIE_DEFAULTS = {'COLORS': ['#0072B2', '#D55E00', '#009E73', '#CC79A7', '#E69F00', '#56B4E9', '#F0E442'], 'MIN_WEDGE_SIZE': 0.04, 'OTHER_THRESHOLD': 0.05, 'SETTINGS': {'autopct': '%1.1f%%', 'counterclock': False, 'shadow': False, 'startangle': 90}}

Default Pie Chart Plot Settings.

hybkit.plot.BAR_DEFAULTS = {'BAR_ALIGN': 'edge', 'BAR_EDGE_COLOR': None, 'BAR_WIDTH': 0.9}

Default Bar Chart Plot Settings.

hybkit.plot.BAR_INT_DEFAULTS = {'BAR_ALIGN': 'center', 'BAR_EDGE_COLOR': None, 'BAR_WIDTH': 0.9}

Default Bar Chart of Integer Plot Settings.

hybkit.plot.ENERGY_DEFAULTS = {'MIN_COUNT': 0, 'MIN_DENSITY': 0.0, 'XLABEL': 'Hybrid Gibbs Free Energy (kcal/mol)', 'YLABEL': 'Hybrid Count'}

Default Bar Chart Plot Settings for Energy Histograms.

hybkit.plot.energy_histogram(results: Dict[str, Any], plot_file_name: str, title: str, name: Optional[str] = None, rc_params: Dict[str, Any] = {'axes.labelweight': 'bold', 'axes.titlepad': 15, 'axes.titlesize': 'large', 'axes.titleweight': 'bold', 'figure.dpi': 1200, 'figure.figsize': [6.4, 4.8]}, bar_params: Dict[str, Any] = {'BAR_ALIGN': 'edge', 'BAR_EDGE_COLOR': None, 'BAR_WIDTH': 0.9}) None

Plot histogram of hybrid energies from an Analysis fold analysis.

Parameters
  • results (dict) -- Dictionary of energy counts from an Analysis fold analysis (Key: binned_energy_vals).

  • plot_file_name (str) -- Name of output file.

  • title (str) -- Title of plot.

  • name (str, optional) -- Name of analysis to be included in plot title.

  • rc_params (dict, optional) -- Dictionary of mpl rcParams. Defaults to ENERGY_HIST_RC_PARAMS.

  • bar_params (dict, optional) -- Dictionary of bar plot parameters. Defaults to BAR_DEFAULTS.

hybkit.plot.type_count(results: Counter, plot_file_name: str, title: str, name: Optional[str] = None, join_entries: bool = False, rc_params: Dict[str, Any] = {'axes.labelweight': 'bold', 'axes.titlepad': 15, 'axes.titleweight': 'bold', 'figure.dpi': 1200, 'figure.figsize': [6.4, 4.8]}) None

Plot pie chart of hybrid type counts from an Analysis type analysis.

Parameters
  • results (Counter) -- Counter Object of type counts from an Analysis type analysis.

  • plot_file_name (str) -- Name of output file.

  • title (str) -- Title of plot.

  • name (str, optional) -- Name of analysis to be included in plot title.

  • join_entries (bool, optional) -- If True, join two-tuple pairs into a single string for plot labels.

  • rc_params (dict, optional) -- Dictionary of mpl rcParams. Defaults to TYPE_PIE_RC_PARAMS.

hybkit.plot.type_count_dual(results: Counter, plot_file_name: str, title: str, name: Optional[str] = None, join_entries: bool = False, rc_params: Dict[str, Any] = {'axes.labelweight': 'bold', 'axes.titlepad': 15, 'axes.titleweight': 'bold', 'figure.dpi': 1200, 'figure.figsize': (8, 4.8)}) None

Plot pie chart of hybrid type counts from an Analysis type analysis.

Parameters
  • results (Counter) -- Counter Object of type counts from an Analysis type analysis.

  • plot_file_name (str) -- Name of output file.

  • title (str) -- Title of plot.

  • name (str, optional) -- Name of analysis to be included in plot title.

  • join_entries (bool, optional) -- If True, join two-tuple pairs into a single string for plot labels.

  • rc_params (dict, optional) -- Dictionary of mpl rcParams. Defaults to TYPE_PIE_RC_PARAMS.

hybkit.plot.target_count(*args, **kwargs) None

Plot pie chart of target counts from an Analysis type analysis.

Parameters
  • results (Counter) -- Counter Object of type counts from an Analysis type analysis.

  • plot_file_name (str) -- Name of output file.

  • title (str) -- Title of plot.

  • name (str, optional) -- Name of analysis to be included in plot title.

  • join_entries (bool, optional) -- If True, join two-tuple pairs into a single string for plot labels.

  • rc_params (dict, optional) -- Dictionary of mpl rcParams. Defaults to TARGET_PIE_RC_PARAMS.

hybkit.plot.fold_match_counts_histogram(results: Counter, plot_file_name: str, title: str, name: Optional[str] = None, is_prop: bool = False, rc_params: Dict[str, Any] = {'axes.labelweight': 'bold', 'axes.titlepad': 15, 'axes.titlesize': 'large', 'axes.titleweight': 'bold', 'figure.dpi': 1200, 'figure.figsize': [6.4, 4.8]}, bar_params: Dict[str, Any] = {'BAR_ALIGN': 'center', 'BAR_EDGE_COLOR': None, 'BAR_WIDTH': 0.9}) None

Plot histogram of predicted miRNA/target match count.

Parameters
  • results (Counter) -- Counter Object of match counts from an Analysis type analysis.

  • plot_file_name (str) -- Name of output file.

  • title (str) -- Title of plot.

  • is_prop (bool, optional) -- If True, y axis is proportion.

  • name (str, optional) -- Name of analysis to be included in plot title.

  • rc_params (dict, optional) -- Dictionary of mpl rcParams. Defaults to FOLD_MATCH_HIST_RC_PARAMS.

  • bar_params (dict, optional) -- Dictionary of bar plot parameters. Defaults to BAR_INT_DEFAULTS.

hybkit.plot.fold_mirna_nt_counts_histogram(*args, **kwargs) None

Plot histogram of predicted miRNA/target match count.

Parameters
  • results (Counter) -- Counter Object of match counts from an Analysis type analysis.

  • plot_file_name (str) -- Name of output file.

  • title (str) -- Title of plot.

  • is_prop (bool, optional) -- If True, y axis is proportion.

  • name (str, optional) -- Name of analysis to be included in plot title.

  • rc_params (dict, optional) -- Dictionary of mpl rcParams. Defaults to FOLD_NT_COUNTS_HIST_RC_PARAMS.

  • bar_params (dict, optional) -- Dictionary of bar plot parameters. Defaults to BAR_INT_DEFAULTS.

hybkit.settings

This module contains settings information for hybkit classes and methods.

hybkit.settings.HYB_SUFFIXES = ['.hyb', '.Hyb', '.HYB']

Allowed suffixes for "Hyb" files.

hybkit.settings.VIENNA_SUFFIXES = ['.vienna', '.Vienna', '.VIENNA']

Allowed suffixes for "Vienna" files.

hybkit.settings.CT_SUFFIXES = ['.ct', '.Ct', '.CT']

Allowed suffixes for "Connection-Table" files.

hybkit.settings.FOLD_SUFFIXES = ['.vienna', '.Vienna', '.VIENNA', '.ct', '.Ct', '.CT']

Allowed suffixes for "Vienna" and "Connection-Table" files.

hybkit.settings.MIRNA_TYPES = ['miRNA', 'microRNA']

Default miRNA types for use in mirna_analysis().

hybkit.settings.HybRecord_settings_info

Information for settings of HybRecord class. Copied into HybRecord_settings for use at runtime.

hybkit.settings.HybRecord_settings_info = {
'allow_undefined_flags': {'Argp-Flag': None,
                           'Argp-Opts': {'const': True, 'nargs': '?'},
                           'Argp-Type': 'custom_bool_from_str',
                           'Def-Val': False,
                           'Desc.': 'Allow use of flags not defined in the '
                                    'hybkit-specification order when reading and '
                                    'writing hyb records. As the preferred '
                                    'alternative to using this setting, the '
                                    '--custom_flags argument can be be used to '
                                    'supply custom allowed flags.'},
 'allow_unknown_seg_types': {'Argp-Flag': None,
                             'Argp-Opts': {'const': True, 'nargs': '?'},
                             'Argp-Type': 'custom_bool_from_str',
                             'Def-Val': False,
                             'Desc.': 'Allow unknown segment types when assigning '
                                      'segment types.'},
 'custom_flags': {'Argp-Flag': None,
                  'Argp-Opts': {'nargs': '+'},
                  'Argp-Type': 'str',
                  'Def-Val': [],
                  'Desc.': 'Custom flags to allow in addition to those specified in '
                           'the hybkit specification.'},
 'hyb_placeholder': {'Argp-Flag': None,
                     'Argp-Opts': {},
                     'Argp-Type': 'str',
                     'Def-Val': '.',
                     'Desc.': 'placeholder character/string for missing data in hyb '
                              'files.'},
 'mirna_types': {'Argp-Flag': None,
                 'Argp-Opts': {'nargs': '+'},
                 'Argp-Type': 'str',
                 'Def-Val': ['miRNA', 'microRNA'],
                 'Desc.': '"seg_type" fields identifying a miRNA'},
 'reorder_flags': {'Argp-Flag': None,
                   'Argp-Opts': {},
                   'Argp-Type': 'custom_bool_from_str',
                   'Def-Val': True,
                   'Desc.': 'Re-order flags to the hybkit-specification order when '
                            'writing hyb records.'}
}
hybkit.settings.HybFile_settings_info

Information for settings of HybFile class. Copied into HybFile_settings for use at runtime.

hybkit.settings.HybFile_settings_info = {
'hybformat_id': {'Argp-Flag': None,
                  'Argp-Opts': {'const': True, 'nargs': '?'},
                  'Argp-Type': 'custom_bool_from_str',
                  'Def-Val': False,
                  'Desc.': 'The Hyb Software Package places further information in '
                           'the "id" field of the hybrid record that can be used to '
                           'infer the number of contained read counts. When set to '
                           'True, the identifiers will be parsed as: '
                           '"<read_id>_<read_count>"'},
 'hybformat_ref': {'Argp-Flag': None,
                   'Argp-Opts': {'const': True, 'nargs': '?'},
                   'Argp-Type': 'custom_bool_from_str',
                   'Def-Val': False,
                   'Desc.': 'The Hyb Software Package uses a reference database '
                            'with identifiers that contain sequence type and other '
                            'sequence information. When set to True, all hyb file '
                            'identifiers will be parsed as: '
                            '"<gene_id>_<transcript_id>_<gene_name>_<seg_type>"'}
}
hybkit.settings.FoldRecord_settings_info

Information for settings of FoldRecord class. Copied into FoldRecord_settings for use at runtime.

hybkit.settings.FoldRecord_settings_info = {
'allowed_mismatches': {'Argp-Flag': None,
                        'Argp-Opts': {},
                        'Argp-Type': 'int',
                        'Def-Val': 0,
                        'Desc.': 'For DynamicFoldRecords, allowed number of '
                                 'mismatches with a HybRecord.'},
 'error_mode': {'Argp-Flag': None,
                'Argp-Opts': {'choices': ['raise', 'warn_return', 'return']},
                'Argp-Type': 'str',
                'Def-Val': 'raise',
                'Desc.': 'Mode for handling errors during reading of HybFiles '
                         "(overridden by HybFoldIter.settings['iter_error_mode'] "
                         'when using HybFoldIter). Options: "raise": Raise an error '
                         'when encountered and exit program ; "warn_return": Print '
                         'a warning and return the error_value ; "return": Return '
                         'the error value with no program output. record is '
                         'encountered.'},
 'fold_placeholder': {'Argp-Flag': None,
                      'Argp-Opts': {},
                      'Argp-Type': 'str',
                      'Def-Val': '.',
                      'Desc.': 'Placeholder character/string for missing data for '
                               'reading/writing fold records.'},
 'seq_type': {'Argp-Flag': '-y',
              'Argp-Opts': {'choices': ['static', 'dynamic']},
              'Argp-Type': 'str',
              'Def-Val': 'static',
              'Desc.': 'Type of fold record object to use. Options: "static": '
                       'FoldRecord, requires an exact sequence match to be paired '
                       'with a HybRecord; "dynamic": DynamicFoldRecord, requires a '
                       'sequence match to the "dynamic" annotated regions of a '
                       'HybRecord, and may be shorter/longer than the original '
                       'sequence.'}
}
hybkit.settings.FoldFile_settings_info

Information for settings of FoldFile class. Copied into FoldFile_settings for use at runtime.

hybkit.settings.FoldFile_settings_info = {

}
hybkit.settings.HybFoldIter_settings_info

Information for settings of HybFoldIter class. Copied into HybFoldIter_settings for use at runtime.

hybkit.settings.HybFoldIter_settings_info = {
'error_checks': {'Argp-Flag': None,
                  'Argp-Opts': {'choices': ['hybrecord_indel',
                                            'foldrecord_nofold',
                                            'max_mismatch',
                                            'energy_mismatch']},
                  'Argp-Type': 'str',
                  'Def-Val': ['hybrecord_indel',
                              'foldrecord_nofold',
                              'max_mismatch',
                              'energy_mismatch'],
                  'Desc.': 'Error checks for simultaneous HybFile and FoldFile '
                           'parsing. Options: "hybrecord_indel": Error for '
                           'HybRecord objects where one/both sequences have '
                           'insertions/deletions in alignment, which prevents '
                           'matching of sequences; "foldrecord_nofold": Error when '
                           'failure in reading a fold_record object; '
                           '"max_mismatch": Error when mismatch between hybrecord '
                           'and foldrecord sequences is greater than FoldRecord '
                           '"allowed_mismatches" setting; "energy_mismatch": Error '
                           'when a mismatch exists between HybRecord and FoldRecord '
                           'energy values.'},
 'iter_error_mode': {'Argp-Flag': None,
                     'Argp-Opts': {'choices': ['raise',
                                               'warn_return',
                                               'warn_skip',
                                               'skip',
                                               'return']},
                     'Argp-Type': 'str',
                     'Def-Val': 'warn_skip',
                     'Desc.': 'Mode for handling errors found during error checks. '
                              'Overrides HybRecord "error_mode" setting when using '
                              'HybFoldIter. Options: "raise": Raise an error when '
                              'encountered; "warn_return": Print a warning and '
                              'return the value; "warn_skip": Print a warning and '
                              'continue to the next iteration; "skip": Continue to '
                              'the next iteration without any output; "return": '
                              'return the value without any error output;'},
 'max_sequential_skips': {'Argp-Flag': None,
                          'Argp-Opts': {},
                          'Argp-Type': 'int',
                          'Def-Val': 100,
                          'Desc.': 'Maximum number of record(-pairs) to skip in a '
                                   'row. Limited as several sequential skips '
                                   'usually indicates an issue with record '
                                   'formatting or a desynchronization between '
                                   'files.'}
}
hybkit.settings.Analysis_settings_info

Information for settings of Analysis class. Copied into Analysis_settings for use at runtime.

hybkit.settings.Analysis_settings_info = {
'out_delim': {'Argp-Flag': None,
               'Argp-Opts': {},
               'Argp-Type': 'str',
               'Def-Val': ',',
               'Desc.': 'Delimiter-string to place between fields in analysis '
                        'output.'},
 'quant_mode': {'Argp-Flag': None,
                'Argp-Opts': {'choices': ['single', 'reads', 'records']},
                'Argp-Type': 'str',
                'Def-Val': 'single',
                'Desc.': 'Method for counting records. Options: "single": Count '
                         'each record as a single entry; "reads": Use the number of '
                         'reads per hyb record as the count (may contain PCR '
                         'duplicates); "records": Count the number of records '
                         'represented by each hyb record entry (1 for "unmerged" '
                         'records, >= 1 for "merged" records)'}
}
hybkit.settings.HybRecord_settings = {'allow_undefined_flags': False, 'allow_unknown_seg_types': False, 'custom_flags': [], 'hyb_placeholder': '.', 'mirna_types': ['miRNA', 'microRNA'], 'reorder_flags': True}

Settings for HybRecord, created from HybRecord_settings_info

hybkit.settings.HybFile_settings = {'hybformat_id': False, 'hybformat_ref': False}

Settings for HybFile, created from HybFile_settings_info

hybkit.settings.FoldRecord_settings = {'allowed_mismatches': 0, 'error_mode': 'raise', 'fold_placeholder': '.', 'seq_type': 'static'}

Settings for FoldRecord, created from FoldRecord_settings_info

hybkit.settings.FoldFile_settings = {}

Settings for FoldFile, created from FoldFile_settings_info

hybkit.settings.HybFoldIter_settings = {'error_checks': ['hybrecord_indel', 'foldrecord_nofold', 'max_mismatch', 'energy_mismatch'], 'iter_error_mode': 'warn_skip', 'max_sequential_skips': 100}

Settings for HybFoldIter, created from HybFoldIter_settings_info

hybkit.settings.Analysis_settings = {'out_delim': ',', 'quant_mode': 'single'}

Settings for BaseAnalysis, created from Analysis_settings_info

hybkit.util

This module contains helper functions for hybkit's command line scripts.

hybkit.util.get_argparse_doc(docstring: str) str

Get the argparse description from a docstring.

Parameters

docstring (str) -- A docstring.

Returns

A string containing the argparse description.

hybkit.util.dir_exists(dir_name: str) str

Check if a directory exists at the provided path (else raise), and return a normalized path.

Parameters

dir_name (str) -- Name of directory to check for existence.

Returns

A normalized version of the path passed to dir_name.

hybkit.util.file_exists(file_name: str, required_suffixes: Optional[List[str]] = None) str

Check if a file exists at the provided path, and return a normalized path.

Parameters
  • file_name (str) -- Name of file to check for existence.

  • required_suffixes (list, optional) -- List of strings containing file-name suffixes. If provided, a file passed to file-exists must end with one of the strings provided. Otherwise an error will be raised.

Returns

A normalized version of the path passed to file_name.

hybkit.util.hyb_exists(file_name: str) str

Check if a .hyb file exists at the provided path, and return a normalized path.

Wrapper for file_exists() that includes the required suffixes in hybkit.settings.HYB_SUFFIXES.

Parameters

file_name (str) -- Name of file to check for existence.

Returns

A normalized version of the path passed to file_name.

hybkit.util.vienna_exists(file_name: str) str

Check if a .vienna file exists at the provided path, and return a normalized path.

Wrapper for file_exists() that includes the required suffixes in hybkit.settings.VIENNA_SUFFIXES.

Parameters

file_name (str) -- Name of file to check for existence.

Returns

A normalized version of the path passed to file_name.

hybkit.util.ct_exists(file_name: str) str

Check if a .ct file exists at the provided path, and return a normalized path.

Wrapper for file_exists() that includes the required suffixes in hybkit.settings.CT_SUFFIXES.

Parameters

file_name (str) -- Name of file to check for existence.

Returns

A normalized version of the path passed to file_name.

hybkit.util.fold_exists(file_name: str) str

Check if a fold-representing file exists at the provided path, and return a normalized path.

Wrapper for file_exists() that includes the required suffixes in hybkit.settings.FOLD_SUFFIXES.

Parameters

file_name (str) -- Name of file to check for existence.

Returns

A normalized version of the path passed to file_name.

hybkit.util.out_path_exists(file_name: str) str

Check if the directory of the specified output path exists, and return a normalized path.

Parameters

file_name (str) -- Name of path to an output file to check.

Returns

A normalized version of the path passed to file_name.

hybkit.util.make_out_file_name(in_file_name: str, name_suffix: str = 'out', in_suffix: str = '', out_suffix: str = '', out_dir: str = '', seg_sep: str = '_') str

Given an input file name, generate an output file name.

Parameters
  • in_file_name (str) -- Name of input file as template.

  • name_suffix (str) -- Suffix to add to name before file type.

  • in_suffix (str) -- File type suffix on in_file_name (to remove).

  • out_suffix (str) -- File type suffix to add to final output file.

  • out_dir (str) -- Directory path in which to place output file.

  • seg_sep (str) -- Separator string between file name segments.

Returns

An output file path based on the input file template.

hybkit.util.validate_args(args: Namespace, parser: Optional[ArgumentParser] = None) bool

Check supplied arguments to make sure there are no hidden contradictions.

Current checks:
  • If explicit output file names supplied, be sure that they match the number of input files provided.

  • If fold files provided, make sure that they match the number of input hyb files provided.

Parameters
hybkit.util.validate_args_exit(args: Namespace, parser: Optional[ArgumentParser] = None) None

Check supplied arguments using validate_args(), and exit if a conflict exists.

Parameters
hybkit.util.set_setting(setting: str, set_value: Any, verbose: bool = False) str

Take a namespace object as from an argparse parser and update settings.

Each setting in the following settings dictionaries are checked and set where applicable:

Parameters
  • setting (str) -- Name of setting to change

  • set_value (str) -- New value for setting

  • verbose (bool, optional) -- If True, print when changing setting.

hybkit.util.set_settings_from_namespace(nspace: Namespace, verbose: bool = False) None

Take a namespace object as from an argparse parser and update settings.

See set_setting() for details

Parameters
  • nspace (argparse.Namespace) -- Namespace containing settings

  • verbose (bool, optional) -- If True, print when changing setting.

hybkit.errors

Module storing hybkit error classes.

exception hybkit.errors.HybkitError

Base class for Hybkit errors.

Variables

message (str) -- Human-readable string describing the error.

exception hybkit.errors.HybkitArgError

Error raised when an invalid argument is provided to a Hybkit function.

Subclass of HybkitError.

Variables

message (str) -- Human-readable string describing the error.

exception hybkit.errors.HybkitConstructorError

Error raised when a read error occurs.

Subclass of HybkitError.

Variables

message (str) -- Human-readable string describing the error.

exception hybkit.errors.HybkitIterError

Error raised when an error is encountered during Hybkit iteration.

Subclass of HybkitError.

Variables

message (str) -- Human-readable string describing the error.

exception hybkit.errors.HybkitMiscError

Error raised when an error is encountered during Hybkit usage.

Subclass of HybkitError.

Variables

message (str) -- Human-readable string describing the error.

hybkit Toolkit

The hybkit toolkit contains command-line scripts for analysis and manipulation of hyb and fold files. Scripts are implemented in Python3, and the hybkit module must be on the user's PYTHONPATH for script execution.

The command-line options and flags are generated with the Python3 argparse module. Relevant settings pertaining to specific hybkit classes are accessible via command-line flags, as demonstrated in the "shell_analysis" implementations in the Example Analyses.

This version of hybkit includes the following executables:

Utility

Description

hyb_check

Parse a hyb (/fold) file and check for errors

hyb_eval

Evaluate hyb (/fold) records to identify segment types and miRNAs

hyb_filter

Filter a hyb (/fold) file to a specific subset of sequences

hyb_analyze

Perform a type, miRNA, summary, or target analysis on a hyb (/fold) file

Detailed descriptions and usage information are available at each respective script page.

hyb_check

Read one or more hyb (and optional fold) format files and check for errors.

This utility reads in one or more files in hyb-format (see the hybkit Hyb File Specification) and uses hybkit's internal file error checking to check for errors. This can be useful as an initial preparation step for further analyses.

Example system calls:
hyb_check -i my_file_1.hyb -f my_file_1.vienna
hyb_check -i my_file_1.hyb my_file_2.hyb -f my_file_1.vienna \\
    my_file_2.vienna -v --custom_flags myflag
usage: hyb_check [-h] -i PATH_TO/MY_FILE.HYB [PATH_TO/MY_FILE.HYB ...]
                 [-f [PATH_TO/MY_FILE.VIENNA [PATH_TO/MY_FILE.VIENNA ...]]]
                 [--version] [-v | -s]
                 [--mirna_types MIRNA_TYPES [MIRNA_TYPES ...]]
                 [--custom_flags CUSTOM_FLAGS [CUSTOM_FLAGS ...]]
                 [--hyb_placeholder HYB_PLACEHOLDER]
                 [--reorder_flags {True,False}]
                 [--allow_undefined_flags [{True,False}]]
                 [--allow_unknown_seg_types [{True,False}]]
                 [--hybformat_id [{True,False}]]
                 [--hybformat_ref [{True,False}]]
                 [--allowed_mismatches ALLOWED_MISMATCHES]
                 [--fold_placeholder FOLD_PLACEHOLDER] [-y {static,dynamic}]
                 [--error_mode {raise,warn_return,return}]
                 [--error_checks {hybrecord_indel,foldrecord_nofold,max_mismatch,energy_mismatch}]
                 [--iter_error_mode {raise,warn_return,warn_skip,skip,return}]
                 [--max_sequential_skips MAX_SEQUENTIAL_SKIPS]

Named Arguments

-i, --in_hyb

REQUIRED path to one or more hyb-format files with a ".hyb" suffix for use in the evaluation.

-f, --in_fold

REQUIRED path to one or more RNA secondary-structure files with a ".vienna" or ".ct" suffix for use in the evaluation.

--version

Print version and exit.

-v, --verbose

Print verbose output during run.

Default: False

-s, --silent

Print no output during run.

Default: False

Hyb Record Settings

--mirna_types

"seg_type" fields identifying a miRNA

Default: ['miRNA', 'microRNA']

--custom_flags

Custom flags to allow in addition to those specified in the hybkit specification.

Default: []

--hyb_placeholder

placeholder character/string for missing data in hyb files.

Default: "."

--reorder_flags

Possible choices: True, False

Re-order flags to the hybkit-specification order when writing hyb records.

Default: True

--allow_undefined_flags

Possible choices: True, False

Allow use of flags not defined in the hybkit-specification order when reading and writing hyb records. As the preferred alternative to using this setting, the --custom_flags argument can be be used to supply custom allowed flags.

Default: False

--allow_unknown_seg_types

Possible choices: True, False

Allow unknown segment types when assigning segment types.

Default: False

Hyb File Settings

--hybformat_id

Possible choices: True, False

The Hyb Software Package places further information in the "id" field of the hybrid record that can be used to infer the number of contained read counts. When set to True, the identifiers will be parsed as: "<read_id>_<read_count>"

Default: False

--hybformat_ref

Possible choices: True, False

The Hyb Software Package uses a reference database with identifiers that contain sequence type and other sequence information. When set to True, all hyb file identifiers will be parsed as: "<gene_id>_<transcript_id>_<gene_name>_<seg_type>"

Default: False

Fold Record Settings

--allowed_mismatches

For DynamicFoldRecords, allowed number of mismatches with a HybRecord.

Default: 0

--fold_placeholder

Placeholder character/string for missing data for reading/writing fold records.

Default: "."

-y, --seq_type

Possible choices: static, dynamic

Type of fold record object to use. Options: "static": FoldRecord, requires an exact sequence match to be paired with a HybRecord; "dynamic": DynamicFoldRecord, requires a sequence match to the "dynamic" annotated regions of a HybRecord, and may be shorter/longer than the original sequence.

Default: "static"

--error_mode

Possible choices: raise, warn_return, return

Mode for handling errors during reading of HybFiles (overridden by HybFoldIter.settings['iter_error_mode'] when using HybFoldIter). Options: "raise": Raise an error when encountered and exit program ; "warn_return": Print a warning and return the error_value ; "return": Return the error value with no program output. record is encountered.

Default: "raise"

Hyb-Fold Iterator Settings

--error_checks

Possible choices: hybrecord_indel, foldrecord_nofold, max_mismatch, energy_mismatch

Error checks for simultaneous HybFile and FoldFile parsing. Options: "hybrecord_indel": Error for HybRecord objects where one/both sequences have insertions/deletions in alignment, which prevents matching of sequences; "foldrecord_nofold": Error when failure in reading a fold_record object; "max_mismatch": Error when mismatch between hybrecord and foldrecord sequences is greater than FoldRecord "allowed_mismatches" setting; "energy_mismatch": Error when a mismatch exists between HybRecord and FoldRecord energy values.

Default: ['hybrecord_indel', 'foldrecord_nofold', 'max_mismatch', 'energy_mismatch']

--iter_error_mode

Possible choices: raise, warn_return, warn_skip, skip, return

Mode for handling errors found during error checks. Overrides HybRecord "error_mode" setting when using HybFoldIter. Options: "raise": Raise an error when encountered; "warn_return": Print a warning and return the value; "warn_skip": Print a warning and continue to the next iteration; "skip": Continue to the next iteration without any output; "return": return the value without any error output;

Default: "warn_skip"

--max_sequential_skips

Maximum number of record(-pairs) to skip in a row. Limited as several sequential skips usually indicates an issue with record formatting or a desynchronization between files.

Default: 100

Output File Naming:

Output files can be named in two fashions: via automatic name generation, or by providing specific out file names.

Automatic Name Generation:

For output name generation, the default respective naming scheme is used:

hyb_script -i PATH_TO/MY_FILE_1.HYB [...]
    -->  OUT_DIR/MY_FILE_1_ADDSUFFIX.HYB

This output file path can be modified with the arguments {--out_dir, --out_suffix} described below.

The output directory defaults to the current working directory ($PWD), and can be modified with the --out_dir <dir> argument. Note: The provided directory must exist, or an error will be raised. For Example:

hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_dir MY_OUT_DIR
    -->  MY_OUT_DIR/MY_FILE_1_ADDSUFFIX.HYB

The suffix used for output files is based on the primary actions of the script. It can be specified using --out_suffix <suffix>. This can optionally include the ".hyb" final suffix. for Example:

hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_suffix MY_SUFFIX
    -->  OUT_DIR/MY_FILE_1_MY_SUFFIX.HYB
#OR
hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_suffix MY_SUFFIX.HYB
    -->  OUT_DIR/MY_FILE_1_MY_SUFFIX.HYB
Specific Output Names:

Alternatively, specific file names can be provided via the -o/--out_hyb argument, ensuring that the same number of input and output files are provided. This argument takes precedence over all automatic output file naming options (--out_dir, --out_suffix), which are ignored if -o/--out_hyb is provided. For Example:

hyb_script [...] --out_hyb MY_OUT_DIR/OUT_FILE_1.HYB MY_OUT_DIR/OUT_FILE_2.HYB
    -->  MY_OUT_DIR/OUT_FILE_1.hyb
    -->  MY_OUT_DIR/OUT_FILE_2.hyb

Note: The directory provided with output file paths (MY_OUT_DIR above) must exist, otherwise an error will be raised.

hyb_filter

Filter hyb (and corresponding fold) files to meet (or exclude) specific criteria.

This script takes one or more filter and/or exclusion criteria and outputs only those records matching (/excluding) those criteria.

The filter criteria and options are based on the options provided by the hybkit.HybRecord.prop() method of the Hybkit API. For more information see the full documentation for the HybRecord class.

Example System Calls:
hyb_filter -i my_file_1.hyb --filter has_seg_types
# Outputs records that have completed a segtype analysis

hyb_filter -i my_file_1.hyb -f my_file_1.vienna \\
    --include seg_type mRNA
# Outputs hyb and fold records where hyb record has either segtype of mRNA

hyb_filter -i my_file_1.hyb --exclude seg_type mRNA
# Outputs records without either segtype of mRNA

hyb_filter -i my_file_1.hyb --include seg1_type mRNA
# Outputs records with only the first / 5p segtype of mRNA

hyb_filter -i my_file_1.hyb my_file_2.hyb -f my_file_1.vienna my_file_2.vienna \\
    --include seg_type_contains RNA
# Outputs all records with a segtype that includes
#   the string "RNA" (case-sensitive)

hyb_filter -i my_file_1.hyb --filter seg_contains kshv
# Outputs records where either segment identifier contains the
#   the string: "kshv" (case-sensitive)

Multiple filtering options can be used together. The -m / --filter_mode argument determines whether "any" (DEFAULT) or "all" filters are required to be true for inclusion. Note: Matching any exclusion criteria results in exclusion of the record.

Example System Calls (match ALL criteria):
hyb_filter -i my_file_1.hyb -f my_file_1.vienna \\
            --filter seg_contains kshv \\
            --filter_2 seg_type miRNA
# Outputs records with either reference sequence identifier containing "kshv"
#   and with either segment having an assigned segtype of miRNA
Example System Calls (match ANY criteria):
hyb_filter -i my_file_1.hyb --filter_mode any \\
            --filter seg_type miRNA \\
            --filter_2 seg_type lncRNA
# Outputs records containing either segment type matching
#   either "miRNA" or "lncRNA" (case-sensitive)
usage: hyb_filter [-h] -i PATH_TO/MY_FILE.HYB [PATH_TO/MY_FILE.HYB ...]
                  [-f [PATH_TO/MY_FILE.VIENNA [PATH_TO/MY_FILE.VIENNA ...]]]
                  [-o PATH_TO/OUT_FILE.HYB [PATH_TO/OUT_FILE.HYB ...]]
                  [-l PATH_TO/OUT_FILE.VIENNA [PATH_TO/OUT_FILE.VIENNA ...]]
                  [-d OUT_DIR] [-u OUT_SUFFIX] [-m {all,any}]
                  [--skip_dup_id_before] [--skip_dup_id_after]
                  [--filter FILTER [FILTER ...]]
                  [--filter_2 FILTER_2 [FILTER_2 ...]]
                  [--filter_3 FILTER_3 [FILTER_3 ...]]
                  [--exclude EXCLUDE [EXCLUDE ...]]
                  [--exclude_2 EXCLUDE_2 [EXCLUDE_2 ...]]
                  [--exclude_3 EXCLUDE_3 [EXCLUDE_3 ...]] [--set_dataset]
                  [--version] [-v | -s]
                  [--mirna_types MIRNA_TYPES [MIRNA_TYPES ...]]
                  [--custom_flags CUSTOM_FLAGS [CUSTOM_FLAGS ...]]
                  [--hyb_placeholder HYB_PLACEHOLDER]
                  [--reorder_flags {True,False}]
                  [--allow_undefined_flags [{True,False}]]
                  [--allow_unknown_seg_types [{True,False}]]
                  [--hybformat_id [{True,False}]]
                  [--hybformat_ref [{True,False}]]
                  [--allowed_mismatches ALLOWED_MISMATCHES]
                  [--fold_placeholder FOLD_PLACEHOLDER] [-y {static,dynamic}]
                  [--error_mode {raise,warn_return,return}]
                  [--error_checks {hybrecord_indel,foldrecord_nofold,max_mismatch,energy_mismatch}]
                  [--iter_error_mode {raise,warn_return,warn_skip,skip,return}]
                  [--max_sequential_skips MAX_SEQUENTIAL_SKIPS]

Named Arguments

-i, --in_hyb

REQUIRED path to one or more hyb-format files with a ".hyb" suffix for use in the evaluation.

-f, --in_fold

REQUIRED path to one or more RNA secondary-structure files with a ".vienna" or ".ct" suffix for use in the evaluation.

-o, --out_hyb

Optional path to one or more hyb-format file for output (should include a ".hyb" suffix). If not provided, the output for input file "PATH_TO/MY_FILE.HYB" will be used as a template for the output "OUT_DIR/MY_FILE_OUT.HYB".

-l, --out_fold

Optional path to one or more ".vienna" or ".ct"-format files for output (should include appropriate ".vienna"/".ct" suffix). If not provided, the output for input file "PATH_TO/MY_FILE.VIENNA" will be used as a template for the output "OUT_DIR/MY_FILE_OUT.VIENNA".

-d, --out_dir

Path to directory for output of files. Defaults to the current working directory.

Default: $PWD

-u, --out_suffix

Suffix to add to the name of output files, before any file- or analysis-specific suffixes. The file-type appropriate suffix will be added automatically.

Default: "_filtered"

-m, --filter_mode

Possible choices: all, any

Modes for evaluating multiple filters. The "all" mode requires all provided filters to be true for inclusion. The "any" mode requires only one provided filter to be true for inclusion. (Note: matching any exclusion filter is grounds for exclusion of record.)

Default: "all"

--skip_dup_id_before

Skip sequential duplicate read IDs before filtering.

Default: False

--skip_dup_id_after

Skip sequential duplicate read IDs after filtering.

Default: False

--filter

Filter criteria #1. Records matching the criteria will be included in output. Includes a filter type, Ex: "seg_name_contains", and an argument, Ex: "ENST00000340384". (Note: not all filter types require a second argument, for Example: "has_mirna_seg")

--filter_2

Filter criteria #2. Records matching the criteria will be included in output. Includes a filter type, Ex: "seg_name_contains", and an argument, Ex: "ENST00000340384". (Note: not all filter types require a second argument, for Example: "has_mirna_seg")

--filter_3

Filter criteria #3. Records matching the criteria will be included in output. Includes a filter type, Ex: "seg_name_contains", and an argument, Ex: "ENST00000340384". (Note: not all filter types require a second argument, for Example: "has_mirna_seg")

--exclude

Exclusion filter criteria #1. Records matching the criteria will be excluded from output. Includes a filter type, Ex: "seg_name_contains", and an argument, Ex: "ENST00000340384". (Note: not all filter types require a second argument, for Example: "has_mirna_seg")

--exclude_2

Exclusion filter criteria #2. Records matching the criteria will be excluded from output. Includes a filter type, Ex: "seg_name_contains", and an argument, Ex: "ENST00000340384". (Note: not all filter types require a second argument, for Example: "has_mirna_seg")

--exclude_3

Exclusion filter criteria #3. Records matching the criteria will be excluded from output. Includes a filter type, Ex: "seg_name_contains", and an argument, Ex: "ENST00000340384". (Note: not all filter types require a second argument, for Example: "has_mirna_seg")

--set_dataset

Set "dataset" flag to value of the input file name.

Default: False

--version

Print version and exit.

-v, --verbose

Print verbose output during run.

Default: False

-s, --silent

Print no output during run.

Default: False

Hyb Record Settings

--mirna_types

"seg_type" fields identifying a miRNA

Default: ['miRNA', 'microRNA']

--custom_flags

Custom flags to allow in addition to those specified in the hybkit specification.

Default: []

--hyb_placeholder

placeholder character/string for missing data in hyb files.

Default: "."

--reorder_flags

Possible choices: True, False

Re-order flags to the hybkit-specification order when writing hyb records.

Default: True

--allow_undefined_flags

Possible choices: True, False

Allow use of flags not defined in the hybkit-specification order when reading and writing hyb records. As the preferred alternative to using this setting, the --custom_flags argument can be be used to supply custom allowed flags.

Default: False

--allow_unknown_seg_types

Possible choices: True, False

Allow unknown segment types when assigning segment types.

Default: False

Hyb File Settings

--hybformat_id

Possible choices: True, False

The Hyb Software Package places further information in the "id" field of the hybrid record that can be used to infer the number of contained read counts. When set to True, the identifiers will be parsed as: "<read_id>_<read_count>"

Default: False

--hybformat_ref

Possible choices: True, False

The Hyb Software Package uses a reference database with identifiers that contain sequence type and other sequence information. When set to True, all hyb file identifiers will be parsed as: "<gene_id>_<transcript_id>_<gene_name>_<seg_type>"

Default: False

Fold Record Settings

--allowed_mismatches

For DynamicFoldRecords, allowed number of mismatches with a HybRecord.

Default: 0

--fold_placeholder

Placeholder character/string for missing data for reading/writing fold records.

Default: "."

-y, --seq_type

Possible choices: static, dynamic

Type of fold record object to use. Options: "static": FoldRecord, requires an exact sequence match to be paired with a HybRecord; "dynamic": DynamicFoldRecord, requires a sequence match to the "dynamic" annotated regions of a HybRecord, and may be shorter/longer than the original sequence.

Default: "static"

--error_mode

Possible choices: raise, warn_return, return

Mode for handling errors during reading of HybFiles (overridden by HybFoldIter.settings['iter_error_mode'] when using HybFoldIter). Options: "raise": Raise an error when encountered and exit program ; "warn_return": Print a warning and return the error_value ; "return": Return the error value with no program output. record is encountered.

Default: "raise"

Hyb-Fold Iterator Settings

--error_checks

Possible choices: hybrecord_indel, foldrecord_nofold, max_mismatch, energy_mismatch

Error checks for simultaneous HybFile and FoldFile parsing. Options: "hybrecord_indel": Error for HybRecord objects where one/both sequences have insertions/deletions in alignment, which prevents matching of sequences; "foldrecord_nofold": Error when failure in reading a fold_record object; "max_mismatch": Error when mismatch between hybrecord and foldrecord sequences is greater than FoldRecord "allowed_mismatches" setting; "energy_mismatch": Error when a mismatch exists between HybRecord and FoldRecord energy values.

Default: ['hybrecord_indel', 'foldrecord_nofold', 'max_mismatch', 'energy_mismatch']

--iter_error_mode

Possible choices: raise, warn_return, warn_skip, skip, return

Mode for handling errors found during error checks. Overrides HybRecord "error_mode" setting when using HybFoldIter. Options: "raise": Raise an error when encountered; "warn_return": Print a warning and return the value; "warn_skip": Print a warning and continue to the next iteration; "skip": Continue to the next iteration without any output; "return": return the value without any error output;

Default: "warn_skip"

--max_sequential_skips

Maximum number of record(-pairs) to skip in a row. Limited as several sequential skips usually indicates an issue with record formatting or a desynchronization between files.

Default: 100

Output File Naming:

Output files can be named in two fashions: via automatic name generation, or by providing specific out file names.

Automatic Name Generation:

For output name generation, the default respective naming scheme is used:

hyb_script -i PATH_TO/MY_FILE_1.HYB [...]
    -->  OUT_DIR/MY_FILE_1_ADDSUFFIX.HYB

This output file path can be modified with the arguments {--out_dir, --out_suffix} described below.

The output directory defaults to the current working directory ($PWD), and can be modified with the --out_dir <dir> argument. Note: The provided directory must exist, or an error will be raised. For Example:

hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_dir MY_OUT_DIR
    -->  MY_OUT_DIR/MY_FILE_1_ADDSUFFIX.HYB

The suffix used for output files is based on the primary actions of the script. It can be specified using --out_suffix <suffix>. This can optionally include the ".hyb" final suffix. for Example:

hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_suffix MY_SUFFIX
    -->  OUT_DIR/MY_FILE_1_MY_SUFFIX.HYB
#OR
hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_suffix MY_SUFFIX.HYB
    -->  OUT_DIR/MY_FILE_1_MY_SUFFIX.HYB
Specific Output Names:

Alternatively, specific file names can be provided via the -o/--out_hyb argument, ensuring that the same number of input and output files are provided. This argument takes precedence over all automatic output file naming options (--out_dir, --out_suffix), which are ignored if -o/--out_hyb is provided. For Example:

hyb_script [...] --out_hyb MY_OUT_DIR/OUT_FILE_1.HYB MY_OUT_DIR/OUT_FILE_2.HYB
    -->  MY_OUT_DIR/OUT_FILE_1.hyb
    -->  MY_OUT_DIR/OUT_FILE_2.hyb

Note: The directory provided with output file paths (MY_OUT_DIR above) must exist, otherwise an error will be raised.

hyb_eval

Read hyb files (and optional matched fold files) and evaluate the contained hybrids.

This utility reads in one or more files in hyb-format (see the hybkit Hyb File Specification) and corresponding fold files (.vienna or .ct) and evaluates hybrid record properties.

Evaluation Types:

type

Assigns types to each segment within hyb records

mirna

Assigns which segments are a miRNA based on segment types.

type Evaluation:
The 'type' evaluation utilizes the hybkit.HybRecord.eval_types() method to assign the record flags: seg1_type and seg2_type
Example system calls:
$ hyb_eval -t type -i my_file_1.hyb

$ hyb_eval -t type -i my_file_1.hyb -f my_file_1.vienna

$ hyb_eval -t type \\
            -i my_file_1.hyb my_file_2.hyb \\
            -f my_file_1.vienna my_file_2.vienna \\
            --type_method string_match \\
            --type_parameters my_parameters_file.csv \\
            --allow_unknown_seg_types
mirna Evaluation:
The 'mirna' evaluation uses the hybkit.HybRecord.eval_mirna() method to identify properties relating to mirna within the hybrids, including mirna presence and positions. This evaluation requires the seg_type flags to be filled, either by a type evaluation, or by parsing the read using the --hybformat_ref True option with a hyb-format reference. The mirna_seg flag is then set for each record, indicating the presence and position of any miRNA within the hybrid.
Example system calls:
$ hyb_eval -t mirna -i my_file_1.hyb

$ hyb_eval -t mirna -i my_file_1.hyb -f my_file_1.vienna

$ hyb_eval -t mirna -i my_file_1.hyb my_vile_2.hyb \\
            -f my_file_1.vienna my_file_2.vienna \\
            --mirna_types miRNA kshv-miRNA
This can also be combined with the type evaluation, as such:
$ hyb_eval -t type mirna -i my_file_1.hyb \\
            --type_method string_match \\
            --type_parameters my_parameters_file.csv \\
            --allow_unknown_seg_types \\
            --mirna_types miRNA kshv-miRNA
usage: hyb_analysis [-h] -i PATH_TO/MY_FILE.HYB [PATH_TO/MY_FILE.HYB ...]
                    [-f [PATH_TO/MY_FILE.VIENNA [PATH_TO/MY_FILE.VIENNA ...]]]
                    [-o PATH_TO/OUT_FILE.HYB [PATH_TO/OUT_FILE.HYB ...]]
                    [-l PATH_TO/OUT_FILE.VIENNA [PATH_TO/OUT_FILE.VIENNA ...]]
                    [-d OUT_DIR] [-u OUT_SUFFIX]
                    [-t {type,mirna} [{type,mirna} ...]]
                    [--type_method {hybformat,string_match,id_map}]
                    [--type_params_file PATH_TO/PARAMETERS_FILE]
                    [--set_dataset] [--version] [-v | -s]
                    [--mirna_types MIRNA_TYPES [MIRNA_TYPES ...]]
                    [--custom_flags CUSTOM_FLAGS [CUSTOM_FLAGS ...]]
                    [--hyb_placeholder HYB_PLACEHOLDER]
                    [--reorder_flags {True,False}]
                    [--allow_undefined_flags [{True,False}]]
                    [--allow_unknown_seg_types [{True,False}]]
                    [--hybformat_id [{True,False}]]
                    [--hybformat_ref [{True,False}]]
                    [--allowed_mismatches ALLOWED_MISMATCHES]
                    [--fold_placeholder FOLD_PLACEHOLDER]
                    [-y {static,dynamic}]
                    [--error_mode {raise,warn_return,return}]
                    [--error_checks {hybrecord_indel,foldrecord_nofold,max_mismatch,energy_mismatch}]
                    [--iter_error_mode {raise,warn_return,warn_skip,skip,return}]
                    [--max_sequential_skips MAX_SEQUENTIAL_SKIPS]

Named Arguments

-i, --in_hyb

REQUIRED path to one or more hyb-format files with a ".hyb" suffix for use in the evaluation.

-f, --in_fold

REQUIRED path to one or more RNA secondary-structure files with a ".vienna" or ".ct" suffix for use in the evaluation.

-o, --out_hyb

Optional path to one or more hyb-format file for output (should include a ".hyb" suffix). If not provided, the output for input file "PATH_TO/MY_FILE.HYB" will be used as a template for the output "OUT_DIR/MY_FILE_OUT.HYB".

-l, --out_fold

Optional path to one or more ".vienna" or ".ct"-format files for output (should include appropriate ".vienna"/".ct" suffix). If not provided, the output for input file "PATH_TO/MY_FILE.VIENNA" will be used as a template for the output "OUT_DIR/MY_FILE_OUT.VIENNA".

-d, --out_dir

Path to directory for output of files. Defaults to the current working directory.

Default: $PWD

-u, --out_suffix

Suffix to add to the name of output files, before any file- or analysis-specific suffixes. The file-type appropriate suffix will be added automatically.

Default: "_evaluated"

-t, --eval_types

Possible choices: type, mirna

Types of evaluations to perform on input hyb file. (Note: evaluations can be combined, such as "--eval_types type mirna")

Default: ['type']

--set_dataset

Set "dataset" flag to value of the input file name.

Default: False

--version

Print version and exit.

-v, --verbose

Print verbose output during run.

Default: False

-s, --silent

Print no output during run.

Default: False

type Analysis Options

--type_method

Possible choices: hybformat, string_match, id_map

Segment-type finding method to use for type evaluation. For a description of the different methods, see the HybRecord documentation for the eval_types method.

Default: "hybformat"

--type_params_file

Segment-type finding parameters file to use for type evaluation with some type finding methods: {string_match, id_map}. For a description of the different methods, see the HybRecord documentation for the find_seg_types method.

Hyb Record Settings

--mirna_types

"seg_type" fields identifying a miRNA

Default: ['miRNA', 'microRNA']

--custom_flags

Custom flags to allow in addition to those specified in the hybkit specification.

Default: []

--hyb_placeholder

placeholder character/string for missing data in hyb files.

Default: "."

--reorder_flags

Possible choices: True, False

Re-order flags to the hybkit-specification order when writing hyb records.

Default: True

--allow_undefined_flags

Possible choices: True, False

Allow use of flags not defined in the hybkit-specification order when reading and writing hyb records. As the preferred alternative to using this setting, the --custom_flags argument can be be used to supply custom allowed flags.

Default: False

--allow_unknown_seg_types

Possible choices: True, False

Allow unknown segment types when assigning segment types.

Default: False

Hyb File Settings

--hybformat_id

Possible choices: True, False

The Hyb Software Package places further information in the "id" field of the hybrid record that can be used to infer the number of contained read counts. When set to True, the identifiers will be parsed as: "<read_id>_<read_count>"

Default: False

--hybformat_ref

Possible choices: True, False

The Hyb Software Package uses a reference database with identifiers that contain sequence type and other sequence information. When set to True, all hyb file identifiers will be parsed as: "<gene_id>_<transcript_id>_<gene_name>_<seg_type>"

Default: False

Fold Record Settings

--allowed_mismatches

For DynamicFoldRecords, allowed number of mismatches with a HybRecord.

Default: 0

--fold_placeholder

Placeholder character/string for missing data for reading/writing fold records.

Default: "."

-y, --seq_type

Possible choices: static, dynamic

Type of fold record object to use. Options: "static": FoldRecord, requires an exact sequence match to be paired with a HybRecord; "dynamic": DynamicFoldRecord, requires a sequence match to the "dynamic" annotated regions of a HybRecord, and may be shorter/longer than the original sequence.

Default: "static"

--error_mode

Possible choices: raise, warn_return, return

Mode for handling errors during reading of HybFiles (overridden by HybFoldIter.settings['iter_error_mode'] when using HybFoldIter). Options: "raise": Raise an error when encountered and exit program ; "warn_return": Print a warning and return the error_value ; "return": Return the error value with no program output. record is encountered.

Default: "raise"

Hyb-Fold Iterator Settings

--error_checks

Possible choices: hybrecord_indel, foldrecord_nofold, max_mismatch, energy_mismatch

Error checks for simultaneous HybFile and FoldFile parsing. Options: "hybrecord_indel": Error for HybRecord objects where one/both sequences have insertions/deletions in alignment, which prevents matching of sequences; "foldrecord_nofold": Error when failure in reading a fold_record object; "max_mismatch": Error when mismatch between hybrecord and foldrecord sequences is greater than FoldRecord "allowed_mismatches" setting; "energy_mismatch": Error when a mismatch exists between HybRecord and FoldRecord energy values.

Default: ['hybrecord_indel', 'foldrecord_nofold', 'max_mismatch', 'energy_mismatch']

--iter_error_mode

Possible choices: raise, warn_return, warn_skip, skip, return

Mode for handling errors found during error checks. Overrides HybRecord "error_mode" setting when using HybFoldIter. Options: "raise": Raise an error when encountered; "warn_return": Print a warning and return the value; "warn_skip": Print a warning and continue to the next iteration; "skip": Continue to the next iteration without any output; "return": return the value without any error output;

Default: "warn_skip"

--max_sequential_skips

Maximum number of record(-pairs) to skip in a row. Limited as several sequential skips usually indicates an issue with record formatting or a desynchronization between files.

Default: 100

Output File Naming:

Output files can be named in two fashions: via automatic name generation, or by providing specific out file names.

Automatic Name Generation:

For output name generation, the default respective naming scheme is used:

hyb_script -i PATH_TO/MY_FILE_1.HYB [...]
    -->  OUT_DIR/MY_FILE_1_ADDSUFFIX.HYB

This output file path can be modified with the arguments {--out_dir, --out_suffix} described below.

The output directory defaults to the current working directory ($PWD), and can be modified with the --out_dir <dir> argument. Note: The provided directory must exist, or an error will be raised. For Example:

hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_dir MY_OUT_DIR
    -->  MY_OUT_DIR/MY_FILE_1_ADDSUFFIX.HYB

The suffix used for output files is based on the primary actions of the script. It can be specified using --out_suffix <suffix>. This can optionally include the ".hyb" final suffix. for Example:

hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_suffix MY_SUFFIX
    -->  OUT_DIR/MY_FILE_1_MY_SUFFIX.HYB
#OR
hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_suffix MY_SUFFIX.HYB
    -->  OUT_DIR/MY_FILE_1_MY_SUFFIX.HYB
Specific Output Names:

Alternatively, specific file names can be provided via the -o/--out_hyb argument, ensuring that the same number of input and output files are provided. This argument takes precedence over all automatic output file naming options (--out_dir, --out_suffix), which are ignored if -o/--out_hyb is provided. For Example:

hyb_script [...] --out_hyb MY_OUT_DIR/OUT_FILE_1.HYB MY_OUT_DIR/OUT_FILE_2.HYB
    -->  MY_OUT_DIR/OUT_FILE_1.hyb
    -->  MY_OUT_DIR/OUT_FILE_2.hyb

Note: The directory provided with output file paths (MY_OUT_DIR above) must exist, otherwise an error will be raised.

hyb_analyze

Read hyb / vienna files and analyze the fold information in the contained hybrid sequences.

Analysis Types:

Energy

Analysis of values of predicted intra-hybrid folding energy

Type

Analysis of segment types

miRNA

Analysis of miRNA segments distributions

Target

Analysis of mirna target segment names and types

Fold

Analysis of folding data included in the analyzed hyb_records

This utility reads in one or more files in hyb-format (see the hybkit Hyb File Specification) along with a corresponding predicted RNA secondary structure file in the "Vienna" (Vienna Format) or "CT" (CT_Format) formats, and analyzes hybrid secondary structure properties.

For full information on the different analysis types, see the Analyses section of the hybkit documentation.

Example system calls:
$ hyb_analyze -a fold -i my_file_1.hyb -f my_file_1.vienna

$ hyb_analyze -a fold -i my_file_2.hyb -f my_file_2.ct \\
            --make_plots False
usage: hyb_analysis [-h] -i PATH_TO/MY_FILE.HYB [PATH_TO/MY_FILE.HYB ...]
                    [-f [PATH_TO/MY_FILE.VIENNA [PATH_TO/MY_FILE.VIENNA ...]]]
                    [-o PATH_TO/OUT_BASENAME [PATH_TO/OUT_BASENAME ...]]
                    [-d OUT_DIR] [-u OUT_SUFFIX]
                    [-a {energy,type,mirna,target,fold} [{energy,type,mirna,target,fold} ...]]
                    [-n ANALYSIS_NAME] [-p {True,False}] [--version] [-v | -s]
                    [--mirna_types MIRNA_TYPES [MIRNA_TYPES ...]]
                    [--custom_flags CUSTOM_FLAGS [CUSTOM_FLAGS ...]]
                    [--hyb_placeholder HYB_PLACEHOLDER]
                    [--reorder_flags {True,False}]
                    [--allow_undefined_flags [{True,False}]]
                    [--allow_unknown_seg_types [{True,False}]]
                    [--hybformat_id [{True,False}]]
                    [--hybformat_ref [{True,False}]]
                    [--allowed_mismatches ALLOWED_MISMATCHES]
                    [--fold_placeholder FOLD_PLACEHOLDER]
                    [-y {static,dynamic}]
                    [--error_mode {raise,warn_return,return}]
                    [--error_checks {hybrecord_indel,foldrecord_nofold,max_mismatch,energy_mismatch}]
                    [--iter_error_mode {raise,warn_return,warn_skip,skip,return}]
                    [--max_sequential_skips MAX_SEQUENTIAL_SKIPS]
                    [--quant_mode {single,reads,records}]
                    [--out_delim OUT_DELIM]

Named Arguments

-i, --in_hyb

REQUIRED path to one or more hyb-format files with a ".hyb" suffix for use in the evaluation.

-f, --in_fold

REQUIRED path to one or more RNA secondary-structure files with a ".vienna" or ".ct" suffix for use in the evaluation.

-o, --out_basename

Optional path to one or more basename prefixes to use for output. The appropriate suffix will be added based on the specific name. If not provided, the output for input file "PATH_TO/MY_FILE.HYB" will be used as a template for the basename "OUT_DIR/MY_FILE".

-d, --out_dir

Path to directory for output of files. Defaults to the current working directory.

Default: $PWD

-u, --out_suffix

Suffix to add to the name of output files, before any file- or analysis-specific suffixes. The file-type appropriate suffix will be added automatically.

-a, --analysis_types

Possible choices: energy, type, mirna, target, fold

Analysis to perform on input hyb and fold files.

Default: "fold"

-n, --analysis_name

Name / title of analysis data.

-p, --make_plots

Possible choices: True, False

Create plots of analysis output.

Default: True

--version

Print version and exit.

-v, --verbose

Print verbose output during run.

Default: False

-s, --silent

Print no output during run.

Default: False

Hyb Record Settings

--mirna_types

"seg_type" fields identifying a miRNA

Default: ['miRNA', 'microRNA']

--custom_flags

Custom flags to allow in addition to those specified in the hybkit specification.

Default: []

--hyb_placeholder

placeholder character/string for missing data in hyb files.

Default: "."

--reorder_flags

Possible choices: True, False

Re-order flags to the hybkit-specification order when writing hyb records.

Default: True

--allow_undefined_flags

Possible choices: True, False

Allow use of flags not defined in the hybkit-specification order when reading and writing hyb records. As the preferred alternative to using this setting, the --custom_flags argument can be be used to supply custom allowed flags.

Default: False

--allow_unknown_seg_types

Possible choices: True, False

Allow unknown segment types when assigning segment types.

Default: False

Hyb File Settings

--hybformat_id

Possible choices: True, False

The Hyb Software Package places further information in the "id" field of the hybrid record that can be used to infer the number of contained read counts. When set to True, the identifiers will be parsed as: "<read_id>_<read_count>"

Default: False

--hybformat_ref

Possible choices: True, False

The Hyb Software Package uses a reference database with identifiers that contain sequence type and other sequence information. When set to True, all hyb file identifiers will be parsed as: "<gene_id>_<transcript_id>_<gene_name>_<seg_type>"

Default: False

Fold Record Settings

--allowed_mismatches

For DynamicFoldRecords, allowed number of mismatches with a HybRecord.

Default: 0

--fold_placeholder

Placeholder character/string for missing data for reading/writing fold records.

Default: "."

-y, --seq_type

Possible choices: static, dynamic

Type of fold record object to use. Options: "static": FoldRecord, requires an exact sequence match to be paired with a HybRecord; "dynamic": DynamicFoldRecord, requires a sequence match to the "dynamic" annotated regions of a HybRecord, and may be shorter/longer than the original sequence.

Default: "static"

--error_mode

Possible choices: raise, warn_return, return

Mode for handling errors during reading of HybFiles (overridden by HybFoldIter.settings['iter_error_mode'] when using HybFoldIter). Options: "raise": Raise an error when encountered and exit program ; "warn_return": Print a warning and return the error_value ; "return": Return the error value with no program output. record is encountered.

Default: "raise"

Hyb-Fold Iterator Settings

--error_checks

Possible choices: hybrecord_indel, foldrecord_nofold, max_mismatch, energy_mismatch

Error checks for simultaneous HybFile and FoldFile parsing. Options: "hybrecord_indel": Error for HybRecord objects where one/both sequences have insertions/deletions in alignment, which prevents matching of sequences; "foldrecord_nofold": Error when failure in reading a fold_record object; "max_mismatch": Error when mismatch between hybrecord and foldrecord sequences is greater than FoldRecord "allowed_mismatches" setting; "energy_mismatch": Error when a mismatch exists between HybRecord and FoldRecord energy values.

Default: ['hybrecord_indel', 'foldrecord_nofold', 'max_mismatch', 'energy_mismatch']

--iter_error_mode

Possible choices: raise, warn_return, warn_skip, skip, return

Mode for handling errors found during error checks. Overrides HybRecord "error_mode" setting when using HybFoldIter. Options: "raise": Raise an error when encountered; "warn_return": Print a warning and return the value; "warn_skip": Print a warning and continue to the next iteration; "skip": Continue to the next iteration without any output; "return": return the value without any error output;

Default: "warn_skip"

--max_sequential_skips

Maximum number of record(-pairs) to skip in a row. Limited as several sequential skips usually indicates an issue with record formatting or a desynchronization between files.

Default: 100

Analysis Settings

--quant_mode

Possible choices: single, reads, records

Method for counting records. Options: "single": Count each record as a single entry; "reads": Use the number of reads per hyb record as the count (may contain PCR duplicates); "records": Count the number of records represented by each hyb record entry (1 for "unmerged" records, >= 1 for "merged" records)

Default: "single"

--out_delim

Delimiter-string to place between fields in analysis output.

Default: ","

Output File Naming:

Output files can be named in two fashions: via automatic name generation, or by providing specific out file names.

Automatic Name Generation:

For output name generation, the default respective naming scheme is used:

hyb_script -i PATH_TO/MY_FILE_1.HYB [...]
    -->  OUT_DIR/MY_FILE_1_ADDSUFFIX.HYB

This output file path can be modified with the arguments {--out_dir, --out_suffix} described below.

The output directory defaults to the current working directory ($PWD), and can be modified with the --out_dir <dir> argument. Note: The provided directory must exist, or an error will be raised. For Example:

hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_dir MY_OUT_DIR
    -->  MY_OUT_DIR/MY_FILE_1_ADDSUFFIX.HYB

The suffix used for output files is based on the primary actions of the script. It can be specified using --out_suffix <suffix>. This can optionally include the ".hyb" final suffix. for Example:

hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_suffix MY_SUFFIX
    -->  OUT_DIR/MY_FILE_1_MY_SUFFIX.HYB
#OR
hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_suffix MY_SUFFIX.HYB
    -->  OUT_DIR/MY_FILE_1_MY_SUFFIX.HYB
Specific Output Names:

Alternatively, specific file names can be provided via the -o/--out_hyb argument, ensuring that the same number of input and output files are provided. This argument takes precedence over all automatic output file naming options (--out_dir, --out_suffix), which are ignored if -o/--out_hyb is provided. For Example:

hyb_script [...] --out_hyb MY_OUT_DIR/OUT_FILE_1.HYB MY_OUT_DIR/OUT_FILE_2.HYB
    -->  MY_OUT_DIR/OUT_FILE_1.hyb
    -->  MY_OUT_DIR/OUT_FILE_2.hyb

Note: The directory provided with output file paths (MY_OUT_DIR above) must exist, otherwise an error will be raised.

Example Analyses

This section includes multiple example stepwise analyses of data from a qCLASH experiment described in [Gay2018], with data acquired from the NCBI Gene Expression Omnibus (GEO) accession GSE101978.

Each analysis is implemented both using the Python3 API, and as a sequence of shell executable commands in a bash script. The Python API implementations are generally significantly more efficient as more steps can be performed on a single iteration over the input data.

Each analysis performs quality control steps on the data by checking data integrity (hyb_check) and removing artifactual ribosomal- and mitochondrial-RNA hybrids (hyb_filter). Further filtration may be performed, and then each described analysis is carried out.

Pipeline

Description

Example Type-miRNA Analysis

Quantify the sequence and miRNA types in a hyb file

Example Target Analysis

Analyze targets of a set of miRNAs from a single experiment

Example Grouped Target Analysis

Analyze and plot targets of a set of miRNAs from pooled experimental replicates

Example Fold Analysis

Analyze and plot predicted miRNA folding patterns in miRNA-containing hybrids

Further details on each respective example analysis can be found in each section.

Example Type-miRNA Analysis

This directory contains a example analysis of Hyb-format data, published in the quick Crosslinking and Sequencing of Hybrids (qCLASH) experiment described in: Gay, Lauren A., et al. "Modified cross-linking, ligation, and sequencing of hybrids (qCLASH) identifies Kaposi's Sarcoma-associated herpesvirus microRNA targets in endothelial cells." Journal of virology 92.8 (2018): e02138-17.

The analysis is carried out in multiple example implementations which produce identical output:

This analysis first performs quality control on the data. It then summarizes and analyzes the hybrid, segment, and miRNA characteristics of each input file. Analyses for each individual file, and a combined summary analysis are all produced.

The sequencing information is available at NCBI Gene Expression Omnibus (GEO) GSE101978, at:

The data files can be downloaded and uncompressed by using the command:

$ sh ./download_data.sh

The unpacked hyb data-files require ~2 GB of space. The completed output of the analysis requires ~1.5 GB of space.

Type-miRNA Analysis Example Output

_images/combined_analysis_types_hybrid_types.png _images/combined_analysis_types_all_seg.png _images/combined_analysis_types_mirna_hybrids.png

Example Target Analysis

This directory contains a example analysis of Hyb-format data, published in the quick Crosslinking and Sequencing of Hybrids (qCLASH) experiment described in: Gay, Lauren A., et al. "Modified cross-linking, ligation, and sequencing of hybrids (qCLASH) identifies Kaposi's Sarcoma-associated herpesvirus microRNA targets in endothelial cells." Journal of virology 92.8 (2018): e02138-17.

The analysis is carried out in multiple example implementations which produce identical output:

This analysis specifically filters and analyzes the kshv-miR-K12-5 miRNA arising from Kaposi's Sarcoma-Associated Herpesvirus (KSHV), which has the assigned type "KSHV-miRNA". Both individual and summary output files are produced.

Hybrid sequences generated by the Hyb program are available at NCBI Gene Expression Omnibus (GEO) GSE101978, at:

The data files can be downloaded and uncompressed by using the command:

$ sh ./download_data.sh

The unpacked hyb data-file require ~130 MB of space. The completed output of the analysis requires ~20 MB of space.

Target Analysis Example Output

_images/GSM2720020_WT_BR1_kshv-miR-K12-5_only_target_names.png _images/GSM2720020_WT_BR1_kshv-miR-K12-5_only_target_types.png

Example Grouped Target Analysis

This directory contains a example analysis of Hyb-format data, published in the quick Crosslinking and Sequencing of Hybrids (qCLASH) experiment described in: Gay, Lauren A., et al. "Modified cross-linking, ligation, and sequencing of hybrids (qCLASH) identifies Kaposi's Sarcoma-associated herpesvirus microRNA targets in endothelial cells." Journal of virology 92.8 (2018): e02138-17.

The analysis is carried out in multiple example implementations which produce identical output:

This analysis specifically investigates and characterizes miRNA arising from six experimental replicates from two conditions with cells infected with Kaposi's Sarcoma Herpesvirus, which are given the type name "KSHV_miRNA". The hybrid reads from KSHV miRNA are grouped and analyzed toghether. Both individual and summary output files are produced.

Hybrid sequence information created by the Hyb program information is available at NCBI Gene Expression Ombnibus (GEO) GSE101978, at:

The data files can be downloaded and uncompressed by using the command:

$ sh ./download_data.sh"

The unpacked hyb data-file require ~1.3 GB of space. The completed output of the analysis requires ~40 MB of space.

Grouped Target Analysis Example Output

_images/kshv_combined_target_types.png

Example Fold Analysis

This directory contains a example analysis of Hyb-format and Vienna-format data, published in the quick Crosslinking and Sequencing of Hybrids (qCLASH) experiment described in: Gay, Lauren A., et al. "Modified cross-linking, ligation, and sequencing of hybrids (qCLASH) identifies Kaposi's Sarcoma-associated herpesvirus microRNA targets in endothelial cells." Journal of virology 92.8 (2018): e02138-17.

The analysis is carried out in multiple example implementations which produce identical output:

This analysis investigates the predicted folding of miRNA from an experimental replicate infected with Kaposi's Sarcoma-Associated Herpesvirus (KSHV), which are given the type name "KSHV-miRNA". Data from the predicted folding fold for each hybrid record produced by the "Hyb" program are analyzed, and the folds of each KSHV miRNA with a non-miRNA target are characterized to determine the per-base folding folds.

Hybrid sequence information created by the Hyb program and the fold output are provided with the hybkit package in the databases directory, created by downstream analysis of files available at NCBI Gene Expression Omnibus (GEO) GSE101978, at:

The data files can be copied and uncompressed by using the command:

$ sh ./prepare_data.sh

The unpacked data-files require ~150 MB of space. The completed output of the analysis requires ~30 MB of space.

Fold Analysis Example Output

_images/WT_BR1_comp_hOH7_KSHV_hybrids_ua_qc_energy_histogram.png _images/WT_BR1_comp_hOH7_KSHV_hybrids_ua_qc_fold_mirna_nt_counts_histogram.png _images/WT_BR1_comp_hOH7_KSHV_hybrids_ua_qc_fold_mirna_nt_props_histogram.png

About

Renne Lab

Principal Investigator: Rolf Renne
Henry E. Innes Professor of Cancer Research
University of Florida
UF Health Cancer Center
UF Department of Molecular Genetics and Microbiology
UF Genetics Institute

Lead Developer

Changelog

  • 0.3.4 (2023-11) Changes include:

    • Misc Bugfixes and Refinements

    • Switch code linting to Ruff

    • Add hybkit.errors module and HybkitError classes

    • Moved printing of warnings to python logging module

    • Add option for direct passage of file-like object for construction of HybFile and ViennaFile

    • Add HybRecord.to_csv_header(), HybRecord.to_fields(), and HybRecord.to_fields_header() methods

    • Refine description of HybFile.open() constructor method

    • Add typing_extensions dependency

    • Add Python3.8-compatible type hints to API

    • Documentation Updates

  • 0.3.3 (2023-09) Changes include:

    • Misc Bugfixes and Refinements

    • Update integer bar-plot functions

  • 0.3.2 (2023-08) Changes include:

    • Misc Bugfixes and Refinements

    • Add duplicate hybrid filtration (by HybRecord.id) options to hyb_filter

    • Add duplicate hybrid filtration to example analyses

  • 0.3.1 (2023-08) Changes include:

    • Misc Bugfixes and Refinements

    • Add --version flag to scripts

    • Change move scripts output file description to argparse epilog

    • Refine plot functions

    • Change default plot colors to the Bang Wong scheme [Wong2011] for colorblind accessibility

    • Documentation corrections

    • Spellcheck

  • 0.3.0 (2023-04) Major Codebase And API Overhaul. Changes include:

    • Simplifying HybRecord API

    • Simplifying FoldRecord API

    • Unifying settings information for argparse and modules

    • Removing Support for ViennaD format

    • Moving identifier-parsing code to module type_finder

    • Moving target region analysis code to module region_finder

    • Moving code for settings into a "settings" module

    • Renamed HybRecord type_analysis and mirna_analysis to eval_types and eval_mirna, respectively to differentiate from analysis module functions

    • Reimplemented analyses methods within a single Analysis class

    • Added error checking / catching to HybFoldIter

    • Removed Target-Region Analysis and associated files due to lack of archival database information, pending future development

    • Added "dynamic" seq_type to FoldRecord for non-identical fold/hybrid sequence handling

    • Added shell implementation to all example analyses

    • Remove support for Python3.6, Python3.7

    • Migrate to CircleCI for CI/CD

    • Added Pytest unit testing integrated with CircleCI

    • Other Misc. Improvements / Bugfixes

  • 0.2.0 (2020-03) Added Command-line Toolkit. Code Refinements.

  • 0.1.9 (2020-03) Fix for Module Path Finding for Python > 3.6

  • 0.1.8 (2020-03) Streamlining, PyPI / PIP Initial Release

  • 0.1.0 (2020-01) Initial Implementation

References

ViennaFormat
CTFormat
Zuker2003

Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003 Jul 1;31(13):3406-15. doi: 10.1093/nar/gkg595. PMID: 12824337; PMCID: PMC169194.

Hunter2007

J. Hunter, "Matplotlib: A 2D Graphics Environment" in Computing in Science & Engineering, vol. 9, no. 03, pp. 90-95, 2007. doi: 10.1109/MCSE.2007.55

Cock2009

Cock PJ, Antao T, Chang JT, Chapman BA, Cox CJ, Dalke A, Friedberg I, Hamelryck T, Kauff F, Wilczynski B, de Hoon MJ. Biopython: freely available Python tools for computational molecular biology and bioinformatics. Bioinformatics. 2009 Jun 1;25(11):1422-3. doi: 10.1093/bioinformatics/btp163. Epub 2009 Mar 20. PMID: 19304878; PMCID: PMC2682512.

Lorenz2011

Lorenz, R., Bernhart, S.H., Höner zu Siederdissen, C. et al. ViennaRNA Package 2.0. Algorithms Mol Biol 6, 26 (2011). doi: 10.1186/1748-7188-6-26

Wong2011(1,2)

Wong, B. Points of view: Color blindness. Nat Methods 8, 441 (2011). doi: 10.1038/nmeth.1618

Helwak2013

Helwak A, Kudla G, Dudnakova T, Tollervey D. Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65. doi: 10.1016/j.cell.2013.03.043. PMID: 23622248; PMCID: PMC3650559.

Travis2014

Travis AJ, et al. Hyb: a bioinformatics pipeline for the analysis of CLASH (crosslinking, ligation and sequencing of hybrids) data. Methods. 2014 Feb;65(3):263-73. doi: 10.1016/j.ymeth.2013.10.015.

Gay2018

Gay LA, Sethuraman S, Thomas M, Turner PC, Renne R. Modified Cross-Linking, Ligation, and Sequencing of Hybrids (qCLASH) Identifies Kaposi's Sarcoma-Associated Herpesvirus MicroRNA Targets in Endothelial Cells. J Virol. 2018 Mar 28;92(8):e02138-17. doi: 10.1128/JVI.02138-17. PMID: 29386283; PMCID: PMC5874430.